Abstract: Pyridoxal 5′-phosphate (PLP)-dependent enzymes catalyze a diverse range of chem. transformations. Despite their extraordinary functional diversity, no PLP-dependent enzyme is known to catalyze Mannich-type reactions, an important carbon-carbon bond-forming reaction in synthetic organic chem. Here we report the discovery of a biosynthetic enzyme LolT, a PLP-dependent enzyme catalyzing a stereoselective intramol. Mannich reaction to construct the pyrrolizidine core scaffold in loline alkaloids. Importantly, its versatile catalytic activity is harnessed for stereoselective synthesis of a variety of conformationally constrained α,α-disubstituted α-amino acids, which bear vicinal quaternary-tertiary stereocentres and various aza(bi)cyclic backbones, such as indolizidine, quinolizidine, pyrrolidine and piperidine. Furthermore, crystallog. and mutagenesis anal. and computational studies together provided mechanistic insights and structural basis for understanding LolT′s catalytic activity and stereoselectivity. Overall, this work expands the biocatalytic repertoire of carbon-carbon bond-forming enzymes and increases our knowledge of the catalytic versatility of PLP-dependent enzymes.
* All experimental methods are cited from the reference, please refer to the original source for details. We do not guarantee the accuracy of the content in the reference.
Reference：
[1] Journal of Organic Chemistry, 1985, vol. 50, # 10, p. 1582 - 1589
2
[ 111-29-5 ]
[ 591-27-5 ]
[ 27292-50-8 ]
Yield
Reaction Conditions
Operation in experiment
24%
With iron(III) chloride hexahydrate In tetrachloromethane at 160 - 180℃; Autoclave; Inert atmosphere
General procedure: The reactions were carried out ina glass ampoule (V = 10 mL), placed in a stainless-steel micro autoclaves (V = 17 mL) underconstant stirring and controlled heating.The ampoule was charged with FeCl3·6H2O (2.9 mg, 0.01 mmol), niline (0.2 mL, 2.15 mmol),diol (1,4-butanediol 0.38 mL and 1,5-pentanediol 0.45 mL, 4.30 mmol ) and carbon tetrachloride(0.06 mL, 0.65 mmol) in an argon flow. The sealed ampoule was placed in an autoclave. Theautoclave was air-tightly closed and heated at 160-180 for 6-12 h under continuous stirring.After completion of the reaction, the autoclave was cooled to room temperature, the ampoulewas opened, and the reaction mixture was treated with diluted (10percent) hydrochloric acid. Thewater layer was separated, neutralized with 10percent solution of sodium hydroxide, and extractedwith dichloromethane. The organic layer was filtered and the solvent was distilled off. Theresidue was distilled in a vacuum or recrystallized from hexane.
Reference：
[1] Russian Journal of Organic Chemistry, 2006, vol. 42, # 11, p. 1615 - 1621
[2] Organic Process Research and Development, 2016, vol. 20, # 2, p. 568 - 573
[3] Journal of the American Chemical Society, 1939, vol. 61, p. 3439
[4] Journal of the American Chemical Society, 1946, vol. 68, p. 2592,2599
Reference：
[1] Journal of Organic Chemistry USSR (English Translation), 1980, vol. 16, # 10, p. 1728 - 1733[2] Zhurnal Organicheskoi Khimii, 1980, vol. 16, # 10, p. 2032 - 2038
[3] Journal of Organic Chemistry USSR (English Translation), 1980, vol. 16, # 10, p. 1728 - 1733[4] Zhurnal Organicheskoi Khimii, 1980, vol. 16, # 10, p. 2032 - 2038
[5] Journal of Organic Chemistry, 1956, vol. 21, p. 739,743,746[6] Journal of the American Chemical Society, 1956, vol. 78, p. 3484,3485
10
[ 111-29-5 ]
[ 142-68-7 ]
[ 5259-98-3 ]
[ 628-76-2 ]
Reference：
[1] Journal of Organic Chemistry, 1981, vol. 46, # 16, p. 3361 - 3364
[2] Journal of Organic Chemistry, 1983, vol. 48, # 17, p. 2825 - 2828
11
[ 111-29-5 ]
[ 34626-51-2 ]
Yield
Reaction Conditions
Operation in experiment
89.1%
With hydrogen bromide In benzene at 70 - 80℃; for 15 h;
In 250mL three-necked flask add 1a (14 g, 0.135 mol), 40percent hydrobromic acid (28 mL, 0.2 mol) and 60 mL of benzene, 70 ~ 80 ° C oil bath water for 15h, TLC detection, raw material points disappear. Washed successively with 5percent sodium hydroxide solution, 10percent hydrochloric acid and saturated brine, and dried over anhydrous sodium sulfate. The crude product was separated by silica gel column chromatography (petroleum ether: ethyl acetate, V / V = 8: 1) and concentrated to give colorless to pale yellow liquid 2a (20.1g, yield 89.1percent).
80%
With hydrogen bromide In water; toluene for 15 h; Dean-Stark; Reflux
A round bottom flask, equipped with a Dean-Stark trap, wascharged with 1,5-pentanediol (3.71 g, 35.6 mmol), concentratedhydrobromic acid (5 mL), and toluene (75 mL). The mixture wasstirred under refluxed for 15 h. After cooling, the reaction mixturewas extracted with 6 M sodium hydroxide (2 15 mL), 5percent HCl(2 15 mL), water (2 15 mL) and brine (20 mL). The organicswere dried over sodium sulfate and concentrated under reducedpressure to yield the title compound as an orange/brown oil(4.75 g, 2.84 mmol, 801H NMR (500 MHz, CDCl3) d 8.16(s, 1H), 7.65 (s, 1H), 7.46 (m, 6H), 7.25 (m 6H), 7.17 (m, 3H), 6.98(m, 3H), 6.48 (m, 4H), 3.59 (br, 2H), 3.11 (br, 4H), 2.65 (q, 12H,J = 7 Hz), 2.11 (br, 2H), 1.61 (m, 2H), 1.52 (m, 4H), 1.45 (m, 2H),1.41 (s, 9H), 1.31 (m, 2H), 1.01 (t, 18H, J = 7 Hz); 13C NMR(125 MHz, CDCl3) d 180.65, 171.21, 156.78, 155.79, 155.64, 146.13,140.35, 138.09, 130.98, 129.19, 128.54, 127.72, 126.14, 124.68,123.33, 120.15, 113.95, 103.13, 79.37, 79.15, 70.77, 47.23, 46.91,45.71, 44.64, 43.29, 29.65, 28.48, 28.14, 27.81, 26.53, 26.10,24.21, 9.07; HRMS (C54H56N4O7S): calculated 904.3870, observed904.3866.
Reference：
[1] Patent: CN105766907, 2016, A, . Location in patent: Paragraph 0026; 0041; 0042
[2] RSC Advances, 2015, vol. 5, # 37, p. 29114 - 29120
[3] Chemistry - A European Journal, 2015, vol. 21, # 30, p. 10721 - 10728
[4] Journal of Physical Chemistry, 1995, vol. 99, # 32, p. 12195 - 12203
[5] Organic Process Research and Development, 2003, vol. 7, # 3, p. 339 - 340
[6] Bioorganic and Medicinal Chemistry, 2014, vol. 22, # 17, p. 4602 - 4608
[7] Synthesis, 1985, # 12, p. 1161 - 1162
[8] Synthetic Communications, 2003, vol. 33, # 10, p. 1809 - 1814
[9] Tetrahedron Letters, 2002, vol. 43, # 2, p. 327 - 329
[10] Tetrahedron, 2005, vol. 61, # 5, p. 1127 - 1140
[11] Tetrahedron Letters, 1996, vol. 37, # 5, p. 625 - 628
[12] Canadian Journal of Chemistry, 1994, vol. 72, # 6, p. 1500 - 1511
[13] Journal of Agricultural and Food Chemistry, 2004, vol. 52, # 14, p. 4368 - 4374
[14] Journal of the American Chemical Society, 2013, vol. 135, # 32, p. 11692 - 11695
[15] Advanced Synthesis and Catalysis, 2000, vol. 342, # 8, p. 779 - 784
[16] Tetrahedron Letters, 1988, vol. 29, # 48, p. 6369 - 6372
[17] Tetrahedron, 1991, vol. 47, # 18, p. 3095 - 3128
[18] Synthetic Communications, 1989, vol. 19, # 7,8, p. 1369 - 1380
[19] Bioscience, Biotechnology, and Biochemistry, 1992, vol. 56, # 12, p. 1962 - 1965
[20] Agricultural and Biological Chemistry, 1985, vol. 49, # 1, p. 141 - 148
[21] Journal of Organic Chemistry, 1997, vol. 62, # 26, p. 9192 - 9202
[22] Bulletin de la Societe Chimique de France, 1994, vol. 131, # 6, p. 699 - 705
[23] Journal of Organic Chemistry, 1995, vol. 60, # 10, p. 2989 - 2999
[24] Synthetic Communications, 2007, vol. 37, # 15, p. 2491 - 2500
[25] Tetrahedron, 2010, vol. 66, # 6, p. 1267 - 1273
[26] Chemical Papers, 2015, vol. 69, # 2, p. 380 - 384
[27] Patent: CN105732654, 2016, A, . Location in patent: Paragraph 0067; 0068
[28] Patent: CN103102266, 2016, B, . Location in patent: Paragraph 0024
12
[ 111-29-5 ]
[ 111-24-0 ]
[ 34626-51-2 ]
Reference：
[1] Journal of Organic Chemistry, 2000, vol. 65, # 18, p. 5837 - 5838
Reference：
[1] European Journal of Medicinal Chemistry, 1981, vol. 16, # 6, p. 515 - 524
[2] Russian Journal of Organic Chemistry, 2013, vol. 49, # 11, p. 1690 - 1702[3] Zh. Org. Khim., 2013, vol. 49, # 11, p. 1707 - 1718,12
[4] Polymer, 2015, vol. 65, p. 45 - 54
15
[ 590-92-1 ]
[ 111-29-5 ]
[ 36840-85-4 ]
Yield
Reaction Conditions
Operation in experiment
75%
With triethylamine In toluene
a) 1,5-Pentamethylene diacrylate 1,5-Pentanediol (15.6 g) was heated in refluxing toluene (500 ml) with 3-bromopropionic acid (50.5 g) and a trace of p-toluenesulphonic acid for 4 hours. The cooled toluene solution was then washed with aqueous sodium acetate solution and treated with triethylamine (50 ml) at reflux. The cooled reaction mixture was washed well with water to remove triethylamine and triethylamine hydrobromide and then the toluene was removed under reduced pressure. The product, 1,5-pentamethylene diacrylate (24.0 g, 75percent yield) was obtained as a pale liquid by high vacuum distillation (b.p. 90°-95° C./0.1 mm Hg).
Reference：
[1] Journal of pharmaceutical sciences, 1974, vol. 63, # 7, p. 1162 - 1163
18
[ 111-29-5 ]
[ 292638-85-8 ]
[ 36840-85-4 ]
[ 57198-94-4 ]
Reference：
[1] Journal of Molecular Catalysis B: Enzymatic, 2010, vol. 62, # 1, p. 80 - 89
19
[ 111-29-5 ]
[ 100-39-0 ]
[ 4541-15-5 ]
Yield
Reaction Conditions
Operation in experiment
89%
Stage #1: With sodium hydride In N,N-dimethyl-formamide; mineral oil at 20℃; for 1 h; Stage #2: at 20℃; for 2 h;
To a stirred suspension of 60percent dispersion of NaH in mineral oil (2.30 g, 57.69 mmol) was added a solution of 1,5-pentanediol 9 (5.0 g, 48.07 mmol) in dry DMF (150 mL) slowly over a period of 15 min at 0 °C. Then reaction mixture was stirred at room temperature for 1 h followed by addition of benzyl bromide (5.75 mL, 48.07 mmol) over 15 min and the stirred for additional 2 h at the same temperature. The reaction mixture was quenched with ice cold water. The crude mixture was extracted with ethyl acetate (2 x 30 mL) and the organic layer was washed with brine (3 times) and dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was purified by silica gel column chromatography using pet ether-ethyl acetate (7:3) as eluent give benzyl ether 10. Yield: 89percent (7.87 g), colorless oil; IR (CHCl3,cm-1): υmax 700, 714, 1028, 1072, 1116, 1177, 1278, 1316, 1388, 1453, 2865, 2938, 3064, 3372; 1H NMR (200 MHz,CDCl3):δ 1.47-1.70 (m, 6H), 3.47 (t, J= 6.3 Hz, 2H), 3.62 (t, J = 6.1 Hz, 2H), 4.49 (s, 2H), 7.31 (s, 5H); 13C NMR (50 MHz, CDCl3):δ 22.3, 29.3, 32.3,62.2, 70.2, 72.8, 127.5, 128.2, 138.3; HRMS (ESI): calc. for [(C12H18O2)H](M+H) 195.1385, found 195.1390.
73%
With sodium hydride In tetrahydrofuran; N,N-dimethyl-formamide; mineral oil at 0℃; for 3 h; Reflux
A flame dried, 500-mL three-necked, round-bottomed flask equipped with a magnetic stirring bar was charged withNaH (8.12 g, 60percent in mineral oil, 203 mmol) and THF (200 mL). To the suspension was added dropwise1,5-pentanediol (16) (42.0 mL, 400 mmol) at 0 °C. The reaction mixture was heated at reflux, and DMF (10 mL) andbenzyl bromide (24.0 mL, 202 mmol) were added dropwise to the mixture at the same temperature. After stirring for 3 h,the resulting suspension was diluted with H2O and the mixture was extracted with EtOAc three times. The combinedorganic extracts were washed with H2O and brine, dried over anhydrous Na2SO4, filtered, and concentrated underreduced pressure. The residue was purified by flash column chromatography on silica gel (hexanes/EtOAc = 7:3 to 4:6)to give alcohol s-1 (28.7 g, 148 mmol, 73percent) as a colorless oil. Its spectral data were identical with those reported.1
70%
With sodium hydride; sodium iodide In N,N-dimethyl-formamide at 0 - 20℃;
1 ,5-Pentandiol (3.430 g, 3.45 mL, 0.033 mol, 4 eq.) was added dropwise to a suspension of NaH (670 mg, 0,016 mol, 2 eq) in DMF (14 mL) at 0°C. A catalytic amount of Nal was added, followed by benzylbromide (1.360 g, 0,95 mL, 0.008 mol, 1 eq.).The mixture was stirred at r.t. overnight.The reaction was quenched with NH4CI aq. sat. and then extracted with ethyl acetate (x3). Organic layers were collected and evaporated under reduced pressure. The crude was purified by flash chromatography eluting from 40percent to 90percent of ethyl acetate in heptane to give the desired product (1.08 g, yield: 70percent)
65%
Stage #1: With sodium hydride In tetrahydrofuran for 4 h; Inert atmosphere; Reflux Stage #2: Inert atmosphere; Reflux
A solution of pentane-1,5-diol (21 mL, 200 mmol) in THF (400 mL) was added drop wise to a stirred suspension of oil free sodium hydride (4.8 g, ∼55percent in oil, 200 mmol) in THF (100 mL) under argon atmosphere. The reaction mixture was heated under reflux for 4 h, cooled to room temperature and benzyl bromide (23.7 mL, 200 mmol) was drop wise added to it. The reaction mixture was heated under reflux overnight, cooled to room temperature and concentrated under reduced pressure. The residue was diluted with water and extracted with ethyl acetate. The organic extract was concentrated under reduced pressure and purified by fractional distillation to give 5-(benzyloxy)pentane-1-ol (25.2 g, 65percent); bp 140–150 °C (bath) (0.4 mbar) as a colorless liquid. p-Toluenesulphonyl chloride (24.8 g, 130 mmol) was added to a stirred solution of 5-(benzyloxy)pentane-1-ol (25.2 g, 130 mmol) in dry pyridine (30 mL) at 0 °C. The reaction mixture was left standing at 4 °C overnight. The reaction mixture was allowed to attain to room temperature, diluted with water and extracted with 15percent ethyl acetate in hexanes. The organic extract was concentrated under reduced pressure to give 5-(benzyloxy)pentyl-1-(4-methyl)benzenesulfonate (42.5 g, 94percent) as a colorless gum. Sodium bromide (13 g, 126 mmol) was added to the stirred solution of 5-(benzyloxy)pentyl-1-(4-methyl)benzenesulfonate (42.5 g, 122 mmol) in DMF (300 mL) and the reaction mixture was heated at 45 °C for 5 h. The reaction mixture was diluted with water, and extracted with 10percent ethyl acetate in hexanes. The organic extract was concentrated to give bromide 2 (31.3 g, 99percent) as a colorless liquid. IR (film): υ 3063, 3029, 2937, 2859, 1646, 1495, 1454, 1362, 1245, 1203, 1103, 1027, 735, 697 cm−1. 1H NMR (200 MHz, CDCl3): δ 1.56–1.73 (m, 4H, 2 × CH2), 1.80–1.95 (m, 2H, CH2CH2Br), 3.41 (t, 2H, 3JHH = 6.8 Hz, OCH2), 3.49 (t, 2H, 3JHH = 6.4 Hz, CH2Br), 4.51 (s, 2H, OCH2Ph), 7.31–7.36 (m, 5H, Ph). 13C NMR (50 MHz, CDCl3): δ 24.9, 28.8, 32.5, 33.7, 69.9, 72.9, 127.5, 127.6 (2C), 128.3 (2C), 138.4.
62%
Stage #1: With sodium hydride In tetrahydrofuran at 0 - 20℃; for 2.5 h; Stage #2: at 0℃; for 4 h; Reflux
At 0° C., 1,5-pentanediol (40 g, 0.39 mol) was added into 200 ml dry THF. Sodium hydride (4.6 g, 0.19 mol) was added in batches within 30 min. The temperature returned to the room temperature for a 2 h reaction. Benzyl bromide (33 g, 0.19 mol) was dissolved in 20 ml THF, which was dropped into the aforementioned system at 0° C. followed by reflux for 4 h. After the complete of the reaction, the reaction was quenched with cold water. The organic phase was extracted with diethyl ether. After drying the organic phase with anhydrous sodium sulfate, it was filtered, then subject to rotatory evaporation to remove the solvent, followed by reduced pressure distillation to obtain 23.1 g of colorless oily liquid 3 with a yield of 62percent. 1H NMR (CDCl3, 400 MHz, ppm) δ: 7.36-7.26 (m, 5H), 4.50 (s, 2H), 3.64-3.61 (t, J=6.5 Hz, 2H), 3.50-3.64 (t, =6.5 Hz, 2H), 1.68-1.54 (m, 4H), 1.49-1.43 (m, 2H).
50%
Stage #1: With sodium hydride In tetrahydrofuran at 25℃; for 1 h; Stage #2: at 25℃;
Into a 1000 mL round-bottom flask, was placed pentane-1, 5-diol (30 g, 288.05 mmol, 1.00 equiv), tetrahydrofuran (500 mL). This was followed by the addition of sodium hydride (13.8 g, 575.00 mmol, 2.00 equiv) in several batches. The mixture was stirred for 1 h at 25 oC. To this was added BnBr (58 g, 339.12 mmol, 1.20 equiv) dropwise with stirring. The resulting solution was stirred overnight at 25 oC. The reaction was then quenched by the addition of 50 mL of water. The resulting solution was extracted with 3x500 mL of ethyl acetate and the organic layers were combined and dried over anhydrous sodium sulfate. The solids were filtered out. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column eluted with ethyl acetate/petroleum ether (1:5). This resulted in 28 g (50percent) of 5-(benzyloxy)pentan-1-ol as colorless oil. (1892) LC-MS m/z: (ES+) [M+H] + = 195; Retention time: 1.01 min; (1893) 1H NMR (300 MHz, CDCl3, 25 oC): 7.35 (s, 5H), 4.52 (s, 2H), 3.65 (t, 2H), 3.51 (t, 2H), 1.69- 1.40 (m, 6H).
Reference：
[1] Journal of the American Chemical Society, 2007, vol. 129, # 5, p. 1465 - 1469
[2] Organic Letters, 2016, vol. 18, # 7, p. 1622 - 1625
[3] Journal of the American Chemical Society, 2015, vol. 137, # 1, p. 420 - 424
[4] Tetrahedron Letters, 2016, vol. 57, # 1, p. 25 - 28
[5] Helvetica Chimica Acta, 2015, vol. 98, # 10, p. 1395 - 1402
[6] Journal of Organic Chemistry, 1995, vol. 60, # 10, p. 2989 - 2999
[7] Tetrahedron, 2009, vol. 65, # 33, p. 6470 - 6488
[8] Journal of Organic Chemistry, 2007, vol. 72, # 4, p. 1104 - 1111
[9] Journal of Medicinal Chemistry, 2011, vol. 54, # 7, p. 2069 - 2079
[10] Chemical Communications, 2006, # 36, p. 3783 - 3785
[11] Tetrahedron, 2005, vol. 61, # 47, p. 11132 - 11140
[12] Tetrahedron Asymmetry, 2004, vol. 15, # 3, p. 565 - 570
[13] Organic Letters, 2004, vol. 6, # 21, p. 3849 - 3852
[14] Tetrahedron, 2010, vol. 66, # 17, p. 3265 - 3274
[15] Synthesis, 2012, vol. 44, # 3, p. 469 - 473
[16] Synlett, 2015, vol. 26, # 7, p. 937 - 941
[17] European Journal of Organic Chemistry, 2012, # 6, p. 1253 - 1258
[18] Journal of Medicinal Chemistry, 2004, vol. 47, # 16, p. 3938 - 3948
[19] Journal of Organic Chemistry, 2010, vol. 75, # 23, p. 8307 - 8310
[20] Synthesis, 2012, vol. 44, # 4, p. 585 - 590
[21] Advanced Synthesis and Catalysis, 2013, vol. 355, # 13, p. 2591 - 2603
[22] Tetrahedron Letters, 2014, vol. 55, # 52, p. 7177 - 7180
[23] Bioorganic Chemistry, 2009, vol. 37, # 2, p. 46 - 51
[24] Patent: WO2018/189554, 2018, A1, . Location in patent: Page/Page column 52
[25] Journal of Organic Chemistry, 2000, vol. 65, # 16, p. 4833 - 4838
[26] Journal of Organic Chemistry, 2008, vol. 73, # 13, p. 5198 - 5201
[27] Synthetic Communications, 2013, vol. 43, # 10, p. 1397 - 1403
[28] Journal of Fluorine Chemistry, 2015, vol. 178, p. 47 - 55
[29] Tetrahedron Letters, 2005, vol. 46, # 23, p. 4023 - 4026
[30] Patent: US2016/2164, 2016, A1, . Location in patent: Paragraph 0114-0116
[31] Organic Letters, 2009, vol. 11, # 15, p. 3270 - 3273
[32] Heterocycles, 2012, vol. 86, # 1, p. 565 - 598
[33] Journal of Medicinal Chemistry, 2013, vol. 56, # 12, p. 5033 - 5047
[34] Patent: WO2018/119441, 2018, A1, . Location in patent: Paragraph 00590
[35] Journal of the American Chemical Society, 2009, vol. 131, # 42, p. 15467 - 15473
[36] Tetrahedron, 2005, vol. 61, # 6, p. 1459 - 1480
[37] Journal of Organic Chemistry, 1971, vol. 36, p. 3526 - 3532
[38] Journal of the American Chemical Society, 1990, vol. 112, # 8, p. 3040 - 3054
[39] Tetrahedron Letters, 1985, vol. 26, # 41, p. 5053 - 5056
[40] Canadian Journal of Chemistry, 1994, vol. 72, # 6, p. 1500 - 1511
[41] Liebigs Annalen, 1995, # 6, p. 965 - 978
[42] Journal of the Chinese Chemical Society, 2002, vol. 49, # 6, p. 1079 - 1088
[43] Tetrahedron, 2003, vol. 59, # 38, p. 7547 - 7553
[44] Tetrahedron Letters, 2006, vol. 47, # 34, p. 6121 - 6123
[45] Organic and Biomolecular Chemistry, 2007, vol. 5, # 16, p. 2678 - 2689
[46] Patent: US2003/69434, 2003, A1,
[47] Patent: US5081287, 1992, A,
[48] Canadian Journal of Chemistry, 2010, vol. 88, # 12, p. 1222 - 1232
[49] Journal of the American Chemical Society, 2012, vol. 134, # 16, p. 6976 - 6979
[50] Tetrahedron Letters, 2013, vol. 54, # 42, p. 5758 - 5760
[51] Patent: US2013/331578, 2013, A1, . Location in patent: Paragraph 0099-0100
20
[ 111-29-5 ]
[ 100-44-7 ]
[ 4541-15-5 ]
Reference：
[1] Journal of the Chemical Society, Perkin Transactions 1: Organic and Bio-Organic Chemistry (1972-1999), 1990, # 1, p. 129 - 132
[2] Journal of Medicinal Chemistry, 2005, vol. 48, # 14, p. 4628 - 4653
[3] Organic and Biomolecular Chemistry, 2006, vol. 4, # 9, p. 1723 - 1729
[4] Liebigs Annalen der Chemie, 1993, # 10, p. 1111 - 1116
[5] Synthetic Communications, 2002, vol. 32, # 14, p. 2187 - 2194
[6] Journal of Organic Chemistry, 2011, vol. 76, # 16, p. 6749 - 6767
[7] European Journal of Medicinal Chemistry, 2003, vol. 38, # 1, p. 1 - 11
[8] Polish Journal of Chemistry, 2002, vol. 76, # 2-3, p. 273 - 284
[9] Organic letters, 2001, vol. 3, # 6, p. 949 - 952
21
[ 111-29-5 ]
[ 100-39-0 ]
[ 4541-15-5 ]
[ 53150-24-6 ]
Reference：
[1] Tetrahedron Letters, 1997, vol. 38, # 34, p. 5945 - 5948
[2] Journal of Medicinal Chemistry, 1995, vol. 38, # 14, p. 2570 - 2581
[3] Synthetic Communications, 1997, vol. 27, # 3, p. 507 - 514
With copper oxide-chromium oxide; water; hydrogen at 180℃;
In water; hydrogen
Comparative Example C1
Preparation of 1,5-pentanediol Comparative Example C1 (in accordance with U.S. Pat. No. 2,546,019) 144.82 g (=1.269 mol) of 2-methoxy-2,3-dihydro-4H-pyran (MOP), 45.76 g (=2.54 mol) of water and 9.4 g of Raney nickel were placed in a stirring autoclave having a gross capacity of 300 ml and the autoclave was pressurized with 100 bar of hydrogen. The reactor was heated while stirring to 150° C. and held at this temperature for 4 hours. The reactor was subsequently cooled and depressurized to atmospheric pressure. The contents of the reactor were filtered, giving 190 g of filtrate. The organic constituents of the filtrate were determined by GC analysis and the water content was determined by Karl-Fischer titration. A pentanediol concentration of 48.1% by weight was found, which corresponds to a total amount of 91.7 g of pentanediol (=0.88 mol).
92.8% by weight
3 Example 3
The distillation yield was thus 92.8% by weight of the 1,5-pentanediol present in the crude product; the total yield based on MOP used was 89.5%. The space-time yield for the 1,5-pentanediol present in the crude product based on the catalyst volume was 475 g/(l*h).
With hydrogen bromide; In octane; water; at 148 - 150℃; for 6h;Dean-Stark;
General procedure: A one-neck rb flask was charged with diol (1equiv), 48% aq HBr (~3 equiv/OH), octane (~7:1 v/w ratio vs diol), fitted tothe fractionating column/Dean-Stark trap, and heated inan oil bath (145-150 C) w/rapid magnetic stirring. The aqueous (lower) layer of the initialazeotrope condensate (bp 89-92 C) was tapped offuntil about half of the theoretical amount of H2O had been collected;the azeotrope temp (still head) then began to rise. The condenser was set to total reflux forseveral h, reopened, and aq material collected for 1h more (head temp 96-100C). The final volume of aq distillatewas 90-100+% of theory (higher-boiling distillate contained up to 24% HBr). When the (pale tan) octane phase containedboth dibromide and bromoalkanol (6band 6c), washing with cold 85% v/v H2SO4 (10 mL,then 5 mL) removed all color and all bromoalkanol. For all three dibromides (3b, 4b, 6b) the neutralized octane solutionwas stripped of solvent (vigreux column, reduced pressure), and the essentiallypure residue (1H NMR) was kugelrohr distilled. A trace of 4-methyltetrahydropyran was foundin 4b before distillation.
To a solution of PS-TPP (100-200 mesh, extent of labeling: ?3mmol/g triphenylphosphine loading) (4.0 equiv) and iodine (4.0 equiv) in anhyd DCM, 1,5-pentandiol (1.0 equiv) was added dropwise. The reaction was stirred at room temperature for 1h, then filtered, to remove triphenylphosphine oxide, and washed with saturated aq Na2S2O3, brine and extracted with DCM. Organic layers were dried (Na2SO4) and evaporated under diminished pressure at room temperature to give the pure 1,5-diiodopentane (10) as a pale yellow oil (95% yield). 1H NMR (500MHz): delta 1.49-1.55 (m, 2H), 1.82-1.88 (m, 4H), 3.19 (t, J=7.0Hz, 4H). 13C NMR (100MHz), delta: 6.3 (2C), 31.1, 32.5 (2C). Anal. calcd for C5H10I2: C, 18.54; H, 3.11; I, 78.35. Found: C, 18.62; H, 3.12.
With bis[dichloro(pentamethylcyclopentadienyl)iridium(III)]; Bis(p-nitrophenyl) phosphate; In toluene; at 100℃; for 36h;Sealed tube; Molecular sieve; Green chemistry;
General procedure: Amine 11 (399.3 mg, 2.0 mmol, 1.0 eq.), diol 14 (379.7 mg, 2.4 mmol, 1.0eq.), were added to a sealed tube, 5.0 mL of toluene was added and stirred. Then [Ir] catalyst 15 (79.7 mg, 0.1 mmol, 0.05eq.) and phosphoric acid 16 (68.1 mg, 0.2 mmol, 0.1eq.), 4 molecular sieve (500.1 mg) was added, heated at 100 C for 36h. The reaction mass was allowed to cool to rt, then washed with 5% NaHCO3 solution, water, evaporated under vacuum. The crude mass was purified by silica gel column chromatography, eluted with 5% ethyl acetate in n-hexane to give clopidogrel (4) as a yellow oil.
With trimethoxysilane; lithium methanolate In tetrahydrofuran for 0.5h; Ambient temperature;
87.7%
With hydrogen In 1,2-dimethoxyethane at 80℃; for 2h;
2B; 4B Example 2B (Synthesis of 1,5-pentanediol)
In the same apparatus as in Example 1, The residue (Ir-Pt -Re catalyst (1)) obtained in Example 1, and 0.342 g (3.0 mmol) of ε-caprolactone were added, It was made up with 1,2-dimethoxyethane to make ε-caprolactone 5%. Pressurized to 8.0 MPa with hydrogen gas, the mixture was reacted at 80 °C. for 2 hours with stirring. After completion of the reaction, the resulting reaction solution was cooled to room temperature, And then filtered through a syringe equipped with a membrane filter (0.45 μm). When the obtained filtrate was analyzed by gas chromatography, The conversion of ε-caprolactone is 100% The yield of 1,6-hexanediol was 92.3% The selectivity was 92.3% The yield of 1-hexanol was 8.0% The selectivity was 8.0%. In Example 1A, The catalyst was added to the Ir-Pt-Re catalyst (2) prepared in Example 2, Except that the 1,2-dimethoxyethane solution of 5% ε-caprolactone was changed to a 50% δ-valerolactone 1,2-dimethoxyethane solution (δ-valerolactone is 7.5 mmol) The reaction was carried out in the same manner as in Example 1A. When the obtained filtrate was analyzed by gas chromatography, the conversion of δ-valerolactone was 92.5% . The yield of 1,5-pentanediol was 87.7%. The selectivity was 94.8%, the yield of 1-pentanol was 4.9%, and the selectivity was 5.3%.
79%
With sodium tetrahydroborate; C36H30F6N10Ni4O10(2+)*2C2F3O2(1-); zinc(II) chloride In tetrahydrofuran at 45℃; for 12h;
75%
With hydrogen; C28H25BrMnN2O2P; lithium tert-butoxide In propan-1-ol at 100℃; for 24h; Autoclave;
73%
With dichloro(benzene)ruthenium(II) dimer; 2-((dicyclohexylphosphino)methyl)-1-methyl-1H-imidazolin; potassium <i>tert</i>-butylate; hydrogen In tetrahydrofuran at 100℃; for 4.5h;
72%
Stage #1: 3,4,5,6-tetrahydro-2H-pyran-2-one With phenylsilane; fac-[Mn-(xantphos)(CO)3Br] at 100℃; for 6h; Inert atmosphere;
Stage #2: With water; sodium hydroxide In methanol at 20℃; Inert atmosphere;
52%
Stage #1: 3,4,5,6-tetrahydro-2H-pyran-2-one With polyethylsiloxane at 100℃; for 24h;
Stage #2: With sodium hydroxide In tetrahydrofuran for 3h; Heating;
With lithium triethylborohydride In various solvent(s) for 0.416667h; ΔH;
With samarium diiodide; water In tetrahydrofuran at 29.9 - 30.1℃; Inert atmosphere; Schlenk technique; chemoselective reaction;
With hydrogen In 1,4-dioxane at 160℃; for 12h;
96 %Spectr.
With (o-PPh2C6H4NH2)[EtNH(CH2)2NHEt]RuCl2; hydrogen; sodium methylate In tetrahydrofuran at 100℃; for 4h; Glovebox; Schlenk technique; Autoclave;
99 %Chromat.
With HN(CH2CH2C3H3N2Mes)2Cl2; potassium <i>tert</i>-butylate; hydrogen; cobalt(II) chloride In tetrahydrofuran at 100℃; for 16h; Autoclave; Glovebox;
93 %Chromat.
With hydrogen In water at 130℃; for 12h; Autoclave;
6 Example 2
General procedure: 1 mmol of β-Butyrolactone serving as the substrate, 100 mg of catalyst (1) [Pt that is 2 mol % of the substrate, Mo that is 0.5 mol % of the substrate, in terms of metal], and 3 mL of water were charged in an autoclave having a Teflon (trade name) inner cylinder and reacted at 130° C. for 12 hours under the condition of hydrogen pressure of 5 MPa to form reaction products. The conversion ratio (cony. [%]) of the substrate was measured using HPLC, and the yield of each one of the reaction products was measured using a gas chromatograph mass spectrometer (GC-MS).
With sodium hypochlorite; sodium hydrogencarbonate; potassium bromide In dichloromethane at 0℃; for 0.5h; chemoselective reaction;
98%
With sodium bromite In water; acetic acid for 10h; Ambient temperature;
97%
With 4-hydroxy-TEMPO benzoate; sodium bromide In dichloromethane; water NaHCO3-buffered at pH 8.6; electrolysis;
97%
With peracetic acid; sodium bromide In ethyl acetate at 39.9℃; for 2h;
97%
With potassium hydroxide; PS-resin; potassium hexacyanoferrate(III) In water; toluene at 20℃; for 3h;
97%
With [RuCl2(PPh3)2(2-PyCH21,3,5-triaza-7-phosphadamantane)].Br; potassium hydroxide In water for 48h; Schlenk technique; Reflux; Inert atmosphere; Green chemistry;
General Procedure for Lactonization of Diols in Presence ofHydrogen Acceptor
General procedure: An aqueous solution containing 1,4-butanediol (0.5 mmol),cyclohexene (5 mmol, 0.506 mL, 10 equiv), KOH (25 mol%,0.007 g, 0.125 mmol), and 1 or 2 (10 mol%, 0.0506 g or 0.051 g,0.05 mmol) was heated to 100 °C for 48 h in a sealed vessel. Oncompletion of the reaction, the products were extracted withDCM and injected into gas chromatography. γ-Butyrolactonewith 73% and 84% yields was observed with the formation ofcyclohexane with 22% and 24% yields.
96%
With oxygen In toluene at 110℃; for 1h;
95%
With tris(cetylpyridinium) 12-tungstophosphate; dihydrogen peroxide In <i>tert</i>-butyl alcohol for 24h; Heating;
95%
With trichloromelamine In dichloromethane for 12h; Ambient temperature;
95%
With (CH3)5C5*Ir(-OCH2C(C6H5)2NH-) In acetone at 20℃; for 24h;
95%
With 1-hydroxytetraphenylcyclopentadienyl(tetraphenyl-2,4-cyclopentadien-1-one)-μ-hydrotetracarbonyldiruthenium(II); {bis(salicylidene-γ-iminopropyl)methylamine}cobalt(II); 2,6-dimethoxy-p-quinone In chlorobenzene at 80℃; for 24h;
94%
With sodium bromite; 4-benzoxy-2,2,6,6-tetramethylpiperidine-N-oxyl; sodium hydrogencarbonate In dichloromethane; water for 3h; Ambient temperature;
94%
With (bipyH2)-CrOCl5 In dichloromethane for 4h; Ambient temperature;
93%
With 5 wt% Pd nanoparticles loaded on phosphate anion exchanged [Mg6Al2(OH)16]CO3*xH2O; air at 50℃; for 6h; Irradiation;
92%
With 2,2,6,6-tetramethyl-piperidine-N-oxyl; Trametes versicolor laccase In aq. acetate buffer at 20℃; for 2.5h; Enzymatic reaction; regioselective reaction;
92%
With C29H35Cl2IrN2O2; sodium acetate In 2,2,2-trifluoroethanol for 20h; Inert atmosphere; Reflux; Schlenk technique;
91%
With N-chloro-succinimide In dichloromethane at 20℃; for 5h;
90%
With trimethylamine-N-oxide; tricarbonyl(η4-1,3-bis(trimethylsilyl)-4,5,6,7-tetrahydro-2H-inden-2-one)iron In acetone at 90℃; for 24h; Sealed tube;
88%
With barium manganate In acetonitrile at 150℃; for 1h; Microwave irradiation;
87%
With aluminum oxide; sodium bromite In dichloromethane for 3h; Ambient temperature;
87%
86%
With 2,2,6,6-tetramethyl-piperidine-N-oxyl; iodosylbenzene; ytterbium(III) triflate In dichloromethane at 20℃; for 1h;
86%
With pyridine; 2,2,6,6-Tetramethyl-1-piperidinyloxy free radical; trichloroisocyanuric acid In acetonitrile Inert atmosphere;
85%
With potassium permanganate; copper(II) sulfate In dichloromethane
85%
With 1-methyl-1H-imidazole; [2,2]bipyridinyl; 2,2,6,6-Tetramethyl-1-piperidinyloxy free radical; tetrakis(acetonitrile)copper(I) trifluoromethanesulfonate In acetonitrile at 22℃; for 6h;
85%
With C25H27BF3N7NiO In toluene for 24h; Glovebox; Schlenk technique; Reflux; Inert atmosphere;
85%
With Iron(III) nitrate nonahydrate; 9-azabicyclo<3.3.1>nonane-N-oxyl In acetonitrile at 20℃; for 15h;
6 Example 6
Fe(NO3)3·9H2O (40.4 mg, 10 mol%) and ABNO (7 mg, 5 mol%) were used in this order.1,5-pentanediol (104 mg, 1 mmol) was added to a 10 ml reaction tube.Then, 2 ml of acetonitrile was added as a solvent, and the reaction was exposed at room temperature, and then the degree of reaction was checked by GC-MS.Reaction 15h,After the reaction is over,An internal standard, n-dodecane, was added and the product was quantitatively analyzed by GC. 1,5-pentanediol conversion rate of 90%,Product yield 85%.
84.1%
With 2,6-dimethylpyridine; (+/-)-cis,cis-4-benzoyloxy-2,2,8a-trimethyldecahydroquino.. at 20℃; Electrolysis;
83%
With allyl methyl carbonate In toluene for 2h; Heating;
82%
Electrolysis;
82%
With platinum In neat (no solvent) at 180℃; for 36h; Inert atmosphere;
82%
With silica gel; N-(2,2,6,6-tetramethyl-1-oxopiperidin-1-ium-4-yl)acetamide tetrafluoroborate In dichloromethane at 20℃; for 72h;
81%
In acetone at 30℃; for 4h;
80%
With 1,1'-bis-(diphenylphosphino)ferrocene; [ruthenium(II)(η6-1-methyl-4-isopropyl-benzene)(chloride)(μ-chloride)]2; potassium carbonate; 4-methyl-2-pentanone for 0.5h; Reflux; Schlenk technique; Inert atmosphere;
77%
With N-iodo-succinimide; silver(I) acetate In benzene for 7h; Heating;
76%
With [{Cu2(5-phenyl-2,8-bis(6′-bipyridinyl)-1,9,10-anthyridine)-(μ-ClO4)2}(PF6)2]; dihydrogen peroxide; sodium acetate In water at 70℃; for 12h;
74%
With manganese(IV) oxide In chloroform for 24h; Heating;
73%
With sodium hypochlorite; 2,2,6,6-tetramethyl-4-(3',3',4',4',5',5',6',6',6'-nonafluorohexyl)-(3'',3'',4'',4'',5'',5'',6'',6'',6''-nonafluorohexan)amidepiperidin-1-oxyl; sodium hydrogencarbonate; potassium bromide In dichloromethane at 0 - 20℃; for 1.33333h; aq. buffer;
72%
With silica gel; sodium hydrogencarbonate; sodium bromide In water at 20℃; Electrochemical reaction;
61%
With [RuCl2(p-cymene)(iPr2-imy)]; potassium hydroxide; tricyclohexylphosphine In 1,3,5-trimethyl-benzene at 163℃; for 18h; Inert atmosphere;
59%
With [bis({2‐[bis(propan‐2‐yl)phosphanyl]ethyl})amine](borohydride)(carbonyl)(hydride)iron(II) In tetrahydrofuran at 120℃; for 24h; Glovebox; Schlenk technique; Inert atmosphere;
59%
With [bis({2‐[bis(propan‐2‐yl)phosphanyl]ethyl})amine](borohydride)(carbonyl)(hydride)iron(II) In toluene at 120℃; for 24h; Glovebox; Schlenk technique; Inert atmosphere;
General Procedure for the Iron-Catalyzed Dehydrogenation of Alcohols
General procedure: In a glovebox, a 50-mL flame-dried Schlenk flask equipped with a condenser was chargedwith an iron catalyst (25 μmol), an alcohol substrate (2.5 or 25 mmol), and 5 mLtoluene. The solution was stirred at 120 °C for a specific time under a constant N2flow. After the reaction, the solution was allowed to cool to room temperature,filtered through a short silica gel column, and eluted with THF. The resultingfiltrate was evaporated under vacuum to afford the pure product.
58%
With C21H35BrMnN2O2P; potassium hydride In toluene for 18h; Schlenk technique; Glovebox; Inert atmosphere; Reflux; Green chemistry;
54.6%
With oxygen In various solvent(s) at 357 - 391℃; for 24h;
54.6%
With oxygen In various solvent(s) at 117.9℃; for 24h;
49%
With benzyltrimethylammonium tribromide; sodium acetate In water; acetic acid at 70℃; for 2.5h;
48%
With N-oxyl-immobilized silica gel; sodium hydrogencarbonate; sodium bromide In water; acetone Electrolysis; solid phase reaction;
43%
With phosphoric acid tributyl ester at 119.84℃; for 8h; Autoclave;
40%
With 1-oxo-4-methoxy-2,2,6,6-tetramethylpiperidinium chloride In dichloromethane at 25℃; for 0.5h;
40%
With sodium bromate In acetic acid at 40℃; for 9.5h;
35%
With sodium bromate; sodium hydrogensulfite In acetonitrile for 2h; Ambient temperature;
22%
at 190℃;
5
100 g of 1,5-pentanediol, 3 g of a hydrogen-activated Cu catalyst which, in the oxidic state, consisted of approx. 60% copper oxide and approx. 40% aluminum oxide were introduced into a glass flask with attached column. After the pressure had been lowered to 100 mbar (absolute) and the bottom had been heated to 190° C., 74.3 g of a mixture of 60.6 g of 1,5-pentanediol and 9.6 g of valerolactone distilled over within 2 hours. In the bottom of the column, 1,5-pentanediol and esters of 5-hydroxypentanoic acid remained. Valerolactone was obtained in 22% yield; the selectivity was >95%.
95 % Chromat.
With acetone In toluene at 180℃; for 2h;
With dihydrogen peroxide In <i>tert</i>-butyl alcohol at 82℃; for 24h; Heating; Yield given;
88 % Chromat.
With IrH5(P-(i-Pr)3)2 In benzene at 75℃; for 48h;
77 % Chromat.
With [π-C5H5N(+)(CH2)15CH3]3(PMo12O40)(3-) In benzene for 2h; Heating;
With pyridine; trichloroisocyanuric acid In dichloromethane Heating;
98 % Chromat.
With 2,6-dimethylpyridine; potassium hydroxide; potassium hexacyanoferrate(III) In toluene at 20℃; for 3h;
89 % Chromat.
With iodosylbenzene; potassium bromide In water for 4h; sonication;
With sodium hypochlorite; 2,2,6,6-tetramethyl-4-(3',3',4',4',5',5',6',6',6'-nonafluorohexyl)-(3'',3'',4'',4'',5'',5'',6'',6'',6''-nonafluorohexan)amidepiperidin-1-oxyl; potassium bromide In dichloromethane at 0℃; for 1h; aq. buffer;
83 %Chromat.
With hydrotalcite-supported copper nanoparticles In 1,3,5-trimethyl-benzene at 150℃; for 10h; Inert atmosphere;
With hydrogen at 10 - 300℃; for 700h;
1
tubular reactor with an internal diameter of 32 mm and an outer jacket which is there to prevent heat losses from the reactor was charged, in a first layer, with 25 ml of a copper catalyst (catalyst 1, 5×3 mm tablets, 21% copper oxide, 2% sodium oxide, remainder SiO2, prepared by impregnating ammoniacal copper carbonate/sodium nitrate solution onto SiO2 extrudates, followed by drying and calcination) and with a second layer below it of 25 ml of a second copper catalyst (catalyst 2, 5 mm extrudates, 13% copper oxide, 1% sodium oxide, 7% CaO, remainder SiO2, prepared by impregnation of ammoniacal copper carbonate/sodium nitrate solution onto CaO/SiO2 extrudates, followed by drying and calcination). Above the tubular reactor there was a heating zone which was used as an evaporator and by means of which the reactor inlet temperature was variable.By means of a nitrogen/hydrogen mixture of 10 to 1 (10 standard liters/h), the catalysts were activated up to 180° C. within 72 h.By means of a pump, thereafter, 1,5-pentanediol (purity 97%, approx. 4 g/h) and hydrogen (10 standard liters/h) were metered in via the evaporator at standard pressure. The temperature at the reactor inlet was set to 300° C. A thermometer at the start of the second catalyst layer measured approx. 260° C. The discharge was cooled to approx. 10° C.; the liquid obtained was collected; the gas was discharged. The reaction was conducted over a period of 700 h, then stopped. After 24 h and even after 700 h, the 1,5-pentanediol conversion was more than 99%. The VLO content in the liquid discharge over this period was between 93 and 94%; the 5-hydroxypentanal intermediate was always significantly below 0.2%. The valerolactone selectivity was accordingly between 96 and 97%.Some of the liquid reaction effluents were distilled. It was possible to achieve VLO purities of more than 99%.
81 %Spectr.
With [RuH(η2-BH4)(2-di-tert-butylphosphinomethyl-6-diethylaminomethylpyridine)] In toluene at 115℃; for 48h; Inert atmosphere;
With oxygen In toluene at 80℃; for 6h;
99 %Chromat.
With HRu(1,3-bis(6'-methyl-2'-pyridylimino)isoindolate)(PPh<SUB>3</SUB>)<SUB>2</SUB> In toluene for 24h; Inert atmosphere; Schlenk technique; Reflux; chemoselective reaction;
With horse-liver alcohol dehydrogenase; 1-(4-hydroxy-3,5-dimethoxy-phenyl)-ethanone; laccase from Myceliopthora thermophila In aq. buffer at 30℃; for 24h; Enzymatic reaction;
93 %Chromat.
With carbon-nitrogen embedded cobalt nanoparticles (800); air In hexane at 25℃; for 96h;
55 %Spectr.
With [bis({2‐[bis(propan‐2‐yl)phosphanyl]ethyl})amine](borohydride)(carbonyl)(hydride)iron(II); potassium carbonate In toluene at 150℃; for 5h; Inert atmosphere; Green chemistry;
62 %Chromat.
With [2,2]bipyridinyl; Iron(III) nitrate nonahydrate; 2,2,6,6-Tetramethyl-1-piperidinyloxy free radical; acetic acid at 25℃; for 24h;
52 %Spectr.
With C21H35BrMnN2O2P; potassium hydride In toluene for 4h; Reflux; Inert atmosphere;
19
6B (5%)/KH (10%) and substrate (1 mmol) internal standard (1 mmol, mesitylene) and toluene (2 mL) were refluxed under Ar flow
64 %Chromat.
With 2,6-dimethylpyridine In water; acetonitrile at 25℃; Electrochemical reaction; Green chemistry;
In toluene at 100℃; for 18h; Schlenk technique;
With oxygen In toluene at 100℃; for 22h;
83 %Spectr.
With B8F16O20P8Pt2(4-)*4C34H72N(1+) In [D3]acetonitrile at 20℃; for 8h; Inert atmosphere; Irradiation;
89 %Chromat.
With [Ru(1,2-bis(diphenylphosphino)benzene )(CO)2Cl2]; potassium <i>tert</i>-butylate; acetone In toluene at 100℃; for 6h;
With hydrogen bromide; In benzene; at 70 - 80℃; for 15h;
In 250mL three-necked flask add 1a (14 g, 0.135 mol), 40% hydrobromic acid (28 mL, 0.2 mol) and 60 mL of benzene, 70 ~ 80 C oil bath water for 15h, TLC detection, raw material points disappear. Washed successively with 5% sodium hydroxide solution, 10% hydrochloric acid and saturated brine, and dried over anhydrous sodium sulfate. The crude product was separated by silica gel column chromatography (petroleum ether: ethyl acetate, V / V = 8: 1) and concentrated to give colorless to pale yellow liquid 2a (20.1g, yield 89.1%).
80%
With hydrogen bromide; In water; toluene; for 15h;Dean-Stark; Reflux;
A round bottom flask, equipped with a Dean-Stark trap, wascharged with 1,5-pentanediol (3.71 g, 35.6 mmol), concentratedhydrobromic acid (5 mL), and toluene (75 mL). The mixture wasstirred under refluxed for 15 h. After cooling, the reaction mixturewas extracted with 6 M sodium hydroxide (2 15 mL), 5% HCl(2 15 mL), water (2 15 mL) and brine (20 mL). The organicswere dried over sodium sulfate and concentrated under reducedpressure to yield the title compound as an orange/brown oil(4.75 g, 2.84 mmol, 801H NMR (500 MHz, CDCl3) d 8.16(s, 1H), 7.65 (s, 1H), 7.46 (m, 6H), 7.25 (m 6H), 7.17 (m, 3H), 6.98(m, 3H), 6.48 (m, 4H), 3.59 (br, 2H), 3.11 (br, 4H), 2.65 (q, 12H,J = 7 Hz), 2.11 (br, 2H), 1.61 (m, 2H), 1.52 (m, 4H), 1.45 (m, 2H),1.41 (s, 9H), 1.31 (m, 2H), 1.01 (t, 18H, J = 7 Hz); 13C NMR(125 MHz, CDCl3) d 180.65, 171.21, 156.78, 155.79, 155.64, 146.13,140.35, 138.09, 130.98, 129.19, 128.54, 127.72, 126.14, 124.68,123.33, 120.15, 113.95, 103.13, 79.37, 79.15, 70.77, 47.23, 46.91,45.71, 44.64, 43.29, 29.65, 28.48, 28.14, 27.81, 26.53, 26.10,24.21, 9.07; HRMS (C54H56N4O7S): calculated 904.3870, observed904.3866.
With hydrogen bromide; In toluene; for 36h;Reflux;
1,5-pentadiol (300mg, 2mmol) dissolved in 10mL of toluene was added HBr (0.3mL, 2.4mmol), refluxed for 36h. The toluene layer was spin-dried to give a colorless oily liquid bodies.
With hydrogen bromide; In toluene; at 120 - 125℃; for 24h;
1,5_ pentanediol (20.8 g, 0.2 mol) was dissolved in 400 mlToluene, 48% hydrobromic acid (40.5 g, 0.24 mol) was added and the reaction was stopped after the reaction was refluxed at 120-125 C for 24 hours.Add appropriate amount of saturated sodium carbonate and, separated from the organic layer, and then extracted with toluene 2 times, dried over anhydrous sodium sulfate and evaporated solvent to get the crude product,5-bromo-pentanol 31.7 g, yield 95%, without further separation directly for the next
With iodine; In acetonitrile; at 120℃; for 0.05h;Microwave irradiation;
General procedure: To a suspension of polymer-bound triphenylphosphine (1.2 mmol) in anhydrous acetonitrile (10 mL) were added iodine (1 mmol) and 1,6-hexanediol diol (1mmol). The reaction mixture was irradiated in microwave reactor at 120 C for 3 min. The reaction mixture was filtered over a filter paper and washed with chloroform.The filtrate was extracted with aqueous sodium thiosulfate solution and dried with anhydrous sodium sulfate.The reafter, solvent was removed under reduced pressure to obtain 6-iodohexan-1-ol (30) in 93%
Pentane-1,5-diol (1 g, 9.62 mmol) was dissolved in dry DCM. Imidazole (0.65 g, 9.62 mmol) and tert-butyldimethylsilyl chloride (1.44 g, 9.62 mmol) were added, and the mixture was stirred at room temperature for overnight. After dilution with Et2O (20 mL), the solution was washed with water (3 x 20 mL), dried over anhydrous Na2SO4 and filtered and evaporated under reduced pressure and purified by column chromatography to furnish the product 20 as a colorless liquid (1.90 g, 91% yield).
84%
With triethylamine; In dichloromethane; at 20℃; for 3h;
To a solution of 1,5-pentanediol (6.00 g, 57.6 mmol) and tert-butyldimethylsilyl chloride 8.68 g, 57.6 mmol) in CH2Cl2 (100 mL)was added triethylamine (12.0 mL, 86.4 mmol). The reaction mixture was stirred for 3 h at room temperature. The reaction mixture was diluted with CH2Cl2, washed with saturated aqueous NH4Cl, dried over anhydrous MgSO4, and concentrated in vacuo. The residue was purified by column chromatography (silica gel, hexane:ethyl acetate = 5:1) to afford 2 (11.20 g, 84% yield) as a colorless oil.1H NMR (300 MHz, CDCl3) ? 3.63 (m, 4H), 1.59 (m, 4H), 1.41 (m, 2H), 0.87 (s, 9H), 0.03 (s, 6H) ppm; 13C NMR (300 MHz, CDCl3) ??63.4,62.7, 32.7, 32.6, 26.2, 22.2, 18.6, -5.1 ppm; IR (KBr) 3348, 2932, 2859, 1472, 1389, 1362, 1255, 1102, 1006, 939, 836, 775 cm-1; HRMS (DART) calcd for [C11H27O2Si]+ : 219.1775, found: 219.1771.
80%
To a suspension of NaH (60% in mineral oil, 394.7 mg, 9.87 mmol) in THF (8.0 mL) at 0 C was added 1,5-pentandiol (1.0 mL, 9.66 mmol). After the reaction mixture was stirred for 1 h, a solution of t-butyldimethylsilyl chloride (1.49 g, 9.85 mmol) in THF (4.0 mL) was added. The resulting moisture was stirred at 0 C to room temperature for overnight, quenched with sat. NH4Cl and extracted with Et2O. The combined organic layer was washed with H2O and brine, dried over Na2SO4, filtered and evaporated. The residue was purified by bulb to bulb distillation to give 5-(t-butyldimethylsilyloxy)-pentan-1-ol1 as a colorless oil (1.69 g, 80%). 1H NMR (500 MHz, CDCl3) 3.65 (t, J = 6.6 Hz, 2 H), 3.62 (t, J = 6.4 Hz, 2H), 1.62-1.53 (m, 4H), 1.44-1.38 (m, 2H), 0.89 (s, 9H), 0.05 (s, 6H).
79%
181. 1,5-Pentanediol (6.3 mL, 60. mmol, 1.0 equiv) was added dropwise to a suspension of NaH (60% dispersion in mineral oil, 2.4 g, 60. mmol, 1.0 equiv) in THF (120 mL) at 25 C (while venting the H2 produced). The resultant reaction mixture was stirred vigorously for 45 min at 25 C, after which TBSC1 (9.0 g, 60. mmol, 1.0 equiv) was added in a single portion. The reaction mixture was then stirred for an additional 2 h at 25 C. Upon completion, the reaction contents were quenched by the careful addition of saturated aqueous NaHC03 (100 mL) and extracted with EtOAc (3 x 50 mL). The combined organic layers were then dried (MgSO/t), filtered, and concentrated. The resultant colorless oil was purified by flash column chromatography (silica gel, hexanes:EtOAc, 4: 1) to afford desymmetrized alcohol 181 (10.3 g, 79% yield) as a colorless viscous oil. 181: R = 0.42 (silica gel, hexanes:EtOAc, 4: 1); IR (film) 3351 (br), 2933, 2859, 1470, 1388, 1254, 1 101 cnT1; ¾ NMR (400 MHz, CDC13) delta 3.65 (t, J = 6.4 Hz, 2 H), 3.62 (t, J= 6.4 Hz, 2 H), 1.63-1.51 (m, 4 H), 1.46-1.37 (m, 2 H), 0.89 (s, 9 H), 0.05 (s, 6 H); 13C NMR (75 MHz, CDC13) delta 63.5, 63.3, 32.9 (2 C), 26.3 (3 C), 22.4, 18.7, -4.9 (2 C); HRMS (FAB) calcd for CuH2702Si [M+H]+ 219.1780, found 219.1779.
75%
To a suspension of NaH (5.04 g, 0.21 mol) in anhydrous THF (300 mL) was added pentane-1,5-diol (10; 20.83 g, 0.20 mol) at 0 C in a dropwise fashion. After complete addition, stirring was continued at 0 C for 15 min. The cooling bath was removed and the mixture stirred for an additional 1 h before a solution of TBSCl (30.14 g, 0.20 mol) in anhydrous THF (100 mL) was slowly added in a dropwise fashion. The yellow suspension was stirred for 12 h at r.t. and then carefully treated with H2O (100 mL). The layers were separated and the aqueous layer was extracted with Et2O (3 × 100 mL). The combined organic layers were washed with saturated NaCl solution, dried with MgSO4, filtered and concentrated in vacuo. The residue was purified by flash chromatography (petroleum ether/Et2O, 2:3) to yield 32.9 g (75%) of silyl ether 11 as a colorless oil. Rf = 0.61 (petroleum ether/Et2O, 2:3). 1H NMR (400 MHz, CDCl3): delta = 0.01 (s, 6 H, Si(CH3)2), 0.86 (s, 9 H, SiC(CH3)3), 1.32-1.39 (m, 2 H, 3-H), 1.48-1.59 (m, 4 H, 2-H, 4-H), 3.56-3.61 (m, 4 H, 1-H, 5-H). 13C NMR (100 MHz, CDCl3): delta = -5.4 (Si(CH3)2), 18.3 (SiC(CH3)3), 22.0 (C-3), 25.9 (SiC(CH3)3), 32.4 (C-2, C-4), 62.7 (C-1), 63.1 (C-5). HRMS (ESI-TOF): m/z [M + H]+ calcd for C11H26O2Si: 219.177483; found: 219.177347.
57%
With triethylamine; In hexane; acetonitrile; at 20℃; for 24h;Inert atmosphere;
General procedure: In a flame-dried100 mL round-bottom flask equipped with a teflon magnetic stir bar,diol(5.0 mmol) was added to acetonitrile (12.5 mL) and hexanes (37.5 mL).Triethylamine (Et3N, 0.84 mL, 6.00 mmol, 1.2 equiv) and tertbutyldimethylsilylchloride (TBSCl, 0.53 g, 5.0 mmol, 1.0 equiv) were addedto the solution and the resulting biphasic mixture was stirred vigorously atroom temperature for 24 h under a N2 atmosphere. The reaction was quenchedwith saturated aqueous ammonium chloride (NH4Cl, 50 mL), and extractedwith ethyl acetate (EtOAc, 3 50 mL). The combined organic phase waswashed with brine (3 50 mL) and dried over anhydrous sodium sulfate(Na2SO4). The crude product was purified by silica gel column chromatography(10-15% EtOAc/hexanes).
With triethylamine; In dichloromethane; at 20℃;Cooling with ice;
General procedure: Diols or diamine (0.048 mol) and triethylamine (4.81 g, 0.057 mol) were dissolved in anhydrous CH2Cl2 (50 mL). (Boc)2O (12.45 g, 0.057 mol) in anhydrous CH2Cl2 solution was added dropwise to the above stirred solution under the ice bath. The mixture was stirred overnight at room temperature, followed by evaporation of the organic solvents. The residue was purified with silica gel column chromatography (dichloromethane/methyl alcohol = 30: 1). The synthesis of naked two primary amine compound according to the literature [29]. Then, acryloyl chloride (6.95 g, 0.077 mol) in anhydrous dichloromethane (50 mL) was added dropwise to a stirred solution of diol or diamine (0.038 mol) and triethylamine (7.77 g, 0.077 mol) in anhydrous dichloromethane (50 mL) under the ice bath. The mixture was stirred overnight at room temperature and then filtered off generated salt, followed by evaporation of the volatile solvent. The residue was purified with silica gel column chromatography (PE: EA = 3: 1, v/v) to give LC1-LC6.
5-[2-(1-(S)-benzyl-2-hydroxy-ethylcarbamoyl)-2-phenyl-ethyl]-2-(4-trifluoromethylphenyl)-7-(4-trifluoromethylphenyl)ethynyl-benzofuran-3-carboxylic acid, 5-hydroxypentyl ester[ No CAS ]
5-[2-(1-(S)-benzyl-2-hydroxy-ethylcarbamoyl)-ethyl]-7-methoxy-2-(4-trifluoromethylphenyl)-benzo[b]furan-3-carboxylic acid, 5-hydroxy-pentyl ester[ No CAS ]
5-[2-(1-(S)-benzyl-2-hydroxy-ethylcarbamoyl)-2-phenyl-ethyl]-2-(4-methoxyphenyl)-7-(4-methoxyphenyl)ethynyl-benzofuran-3-carboxylic acid, 5-hydroxypentyl ester[ No CAS ]
5-[2-(1-(S)-benzyl-2-hydroxy-ethylcarbamoyl)-2-phenyl-ethyl]-2-(4-methylphenyl)-7-(4-methylphenyl)ethynyl-benzofuran-3-carboxylic acid, 5-hydroxypentyl ester[ No CAS ]
Stage #1: 4-hydroxy-3-methoxybenzoic acid methyl ester With di-isopropyl azodicarboxylate; triphenylphosphine In tetrahydrofuran at 0℃; for 1h;
Stage #2: 1 ,5-pentanediol In tetrahydrofuran for 0.5h;
Methyl vanillate (2.18g, 11.98 mmol) and Ph3P (4.71 g, 17.97 mmol) in THF (20 mL) wascooled to 0°C and to which was added DIAD (2.59 mL, 13.18 mmol) dropwise. The reactionwas stirred at 0°C for 1 hr. 1,5-petanediol (0.6 mL, 5.75 mmol) in THF (20 mL) was added over 30 mm. The reaction was stuffed overnight and prESlpitate formed and was collected with filtration. The filtrate was concentrated to form more solid. The solid was combined and triturated with MeOH (5 mL) to give qite clean product EC1624 1.74 g in yield of 70%. ‘HNMR (CDC13, ö in ppm): 7.66(m 2H), 7.62(m, 2H), 6.87(m, 2H), 4.10(m, 4H), 3.89(m, 12H),1.95(m, 4H), 1.69(m, 2H). ‘3C NMR: 166.88, 152.50, 148.86, 132.12, 132.04, 131.88, 128.52,128.42, 123.50, 122.55, 112.35, 111.46, 68.67, 56.03, 51.93, 28.73, 22.52, 21.92.
70%
Stage #1: 4-hydroxy-3-methoxybenzoic acid methyl ester With di-isopropyl azodicarboxylate; triphenylphosphine In tetrahydrofuran at 0℃; for 1h;
Stage #2: 1 ,5-pentanediol In tetrahydrofuran
4.1 Step 1: Preparation of Compound 3.
Methyl vanillate (2.18g, 11.98 mmol) and Ph3P (4.71 g, 17.97 mmol) in THF (20 mL) was cooled to 0°C and to which was added DIAD (2.59 mL, 13.18 mmol) dropwise. The reaction was stirred at 0°C for 1 hr. 1,5-petanediol (0.6 mL, 5.75 mmol) in THF (20 mL) wasadded over 30 mm. The reaction was stirred overnight and prESlpitate formed and was collected with filtration. The filtrate was concentrated to form more solid. The solid was combined and triturated with MeOH (5 mL) to give qite clean product Compound 3 1.74 g in yield of 70%. ‘H NMR (CDC13, in ppm): 7.66(m 2H), 7.62(m, 2H), 6.87(m, 2H), 4.10(m, 4H), 3.89(m, 12H), 1.95(m, 4H), 1.69(m, 2H). ‘3C NMR: 166.88, 152.50, 148.86, 132.12,132.04, 131.88, 128.52, 128.42, 123.50, 122.55, 112.35, 111.46, 68.67, 56.03, 51.93, 28.73,22.52, 21.92.
52%
With triphenylphosphine; diethylazodicarboxylate In tetrahydrofuran at 0 - 20℃;
Stage #1: 4-hydroxy-3-methoxybenzoic acid methyl ester With triphenylphosphine; diethylazodicarboxylate In tetrahydrofuran at 0℃; for 1h;
Stage #2: 1 ,5-pentanediol In tetrahydrofuran at 20℃;
Multi-step reaction with 2 steps
1: 31 percent / sodium hydroxide / H2O / 16 h / 90 °C
2: 71 percent / bromine; triphenylphosphine / acetonitrile / 3 h / 10 - 20 °C
Multi-step reaction with 3 steps
1.1: sodium hydride / tetrahydrofuran / 4 h / Inert atmosphere; Reflux
1.2: Inert atmosphere; Reflux
2.1: pyridine / 0 - 4 °C / Inert atmosphere
3.1: sodium bromide / N,N-dimethyl-formamide / 5 h / 45 °C / Inert atmosphere
Multi-step reaction with 2 steps
1.1: sodium hydride / tetrahydrofuran; mineral oil / 0.5 h / 0 °C
1.2: 16 h / 20 °C
2.1: triphenylphosphine; bromine; pyridine / dichloromethane / 4 h / 0 - 20 °C
With dibenzyl azodicarboxylate; In tetrahydrofuran; at 20℃; for 8h;
A 20 mL scintillation vial with a septum cap was charged with PS-PPh3 resin (Aldrich Chemical Co. , Inc, 132 mg, 4.2 equiv) [2-AMINO-8-HYDROXYQUINOLINE] (154 mg, 10 equiv) and DBAD (70 mg, 3.2 equiv) and purged by passing a stream of N2 for 45 seconds. Anhydr. THF (2.0 [ML)] was added and contents of the vial were agitated for 5 min. Then, a solution of 1,5-pentanediol (10 mg, 0.094 mmol) in anhydr. THF [(1] mL) was added to the vial and the resulting suspension was agitated at room temperature for 8 h. The suspension was then filtered, and the resin washed with DMA (6 x 3.0 mL). The filtrate and washings were combined and evaporated in vacuo. The resulting oily residue was dissolved in 50 mL of EtOAc and washed with aqueous NH3. The solution was then evaporated in vacuo and the residue was dissolved in 3.0 mL of a 1: 1 mixture [OF DMSO/MEOH] and purified by preparative reverse-phase [HPLC. 1H] NMR (500 MHz, [CDC13)] [5] ppm 7.95 (d, 2H), 7.27 [(M,] 2H), 7.21 (m, 2H), 7.14 (d, 2H), 7.05 (m, 2H), 4.20 [(M,] 4H), 2.04 [(M,] 4H), 1.94 (m, [2H) ;] MS (DCI/NH3) m/z 389 [M+H] [+.]
With hydrogen; nitric acid;Ru-Sn-Re catalyst; In water; at 180℃; under 15001.5 - 112511 Torr; for 18h;
10 g of water, 5.0 g of the dicarboxylic acid mixture and 0.3 g of the Ru-Sn-Re catalyst prepared in Reference Example 1 were charged into a 100 ml autoclave made of Hastelloy, which was equipped with a magnetic induction type stirrer. The atmosphere in the autoclave was replaced by nitrogen at room temperature and, then, pressurized hydrogen gas was introduced into the autoclave to increase the internal pressure thereof to 2 MPa, and the internal temperature of the autoclave was elevated to 180 C. After the internal temperature of the autoclave reached 180 C., pressurized hydrogen gas was further introduced into the autoclave to increase the internal pressure thereof to 15 MPa, and then a hydrogenation reaction was performed under the above-mentioned internal pressure for 18 hours. After completion of the hydrogenation reaction, a hydrogenation reaction mixture containing a diol mixture was taken out from the autoclave, while leaving the catalyst in the autoclave. The diol mixture contained in the hydrogenation reaction mixture was analyzed by gas chromatography under the above-mentioned analysis conditions to determine the yields of the diols. As a result, it was found that the yields of 1,4-butanediol, 1,5-pentanediol and 1,6-hexanediol were 75%, 98% and 96%, respectively. [00215] Into the autoclave containing the catalyst therein were charged 5.0 g of the dicarboxylic acid mixture and 10 g of water, and a hydrogenation reaction was performed under substantially the same conditions as mentioned above to produce a diol mixture. This procedure for the hydrogenation of the dicarboxylic acid mixture was further repeated 6 times (i.e., 7 runs of the hydrogenation were performed). With respect to the catalyst used, the activity maintenance ratio (%) was calculated by the formula: {(total amount of 1,4-butanediol, 1,5-pentanediol and 1,6-hexanediol which were obtained in the 7th run of the hydrogenation)/(total amount of 1,4-butanediol, 1,5-pentanediol and 1,6-hexanediol which were obtained in the 1st run of the hydrogenation)}×100. When the activity maintenance ratio is less than 100%, it means that the catalytic activity is lowered. The results are shown in Table 1.
A.5; A.6; A.7
Stufe 5 (Hydrierung); 4,3 kg der C6-Esterfraktion aus Stufe 4 wurden kontinuierlich in einem 25-ml-Reaktor an einem Katalysator hydriert (Katalysator, 70 Gew.-% CuO, 25 Gew.-% ZnO, 5 Gew.-% Al2O3), der zuvor im Wasserstoffstrom bei 180°C aktiviert worden war. Der Zulauf betrug 20 g/h, der Druck 220 bar und die Temperatur 220°C). Der Ester-Umsatz betrug 99,5 %, die 1,6-Hexandiolselektivität betrug über 99%; Stufe 6 und 7; 4,0 kg des Hydrieraustrags aus Stufe 5 wurden fraktioniert destilliert (Destillationsblase mit aufgesetzter 70 cm Füllkörperkolonne, Rücklaufverhältnis 2) Bei 1013 mbar wurde 1 kg Methanol abdestilliert. Nach Anlegen von Vakuum (20 mbar) destillierten überwiegend die 1,2-Cyclohexandiole und 1,5-Pentandiol ab. Danach (Sdp. 146°C) destillierte 1,6-Hexandiol mit einer Reinheit von 99,8 % ab. (Restgehalt überwiegend 1,5-Pentandiol.)
3 Example 3
Example 3 A continuous reaction was carried out using a high-pressure reactor having an internal diameter of 30 mm and a total height of 2000 mm. The reactor is provided with a thermocouple having a diameter of 12 mm arranged axially. The lower part of the reactor is packed with 500 ml of stainless steel Pall rings, above which 500 ml (=760 g) of catalyst A in pellet form and, as uppermost bed, 250 ml of Pall rings are installed. At the bottom of the reactor, 250 g/h of 2-methoxy-2,3-dihydro-4H-pyran (MOP), 250 g/h of water and 500 g/h of the liquid reaction product are fed in via separate lines. Hydrogen was introduced at the bottom of the reactor, with the amount of hydrogen being regulated so that the off-gas flow was constant at 100 standard 1/h. The reactor was operated in the upflow mode at 150° C. under a hydrogen pressure of 200 bar absolute. The reactor product was cooled and depressurized to atmospheric pressure, and the part of the reactor product which was not recirculated was taken off as crude product. The crude product comprised 42% by weight of water, 1.6% by weight of tetrahydropyran, 8.7% by weight of methanol, 47.5% by weight of 1,5-pentanediol and 0.2% by weight of further organic by-products. The conversion based on MOP was 100%, and the yield of 1,5-pentanediol was 96.4% based on MOP used. The crude product (500 g) was subjected to a simple distillation in which it was firstly dewatered under atmospheric pressure to give 259 g of distillate (water and methanol) and subsequently distilled at 30 mbar, giving 220.5 g of pentanediol having a purity of 99% by weight.
a) 1,5-Pentamethylene diacrylate 1,5-Pentanediol (15.6 g) was heated in refluxing toluene (500 ml) with 3-<strong>[590-92-1]bromopropionic acid</strong> (50.5 g) and a trace of p-toluenesulphonic acid for 4 hours. The cooled toluene solution was then washed with aqueous sodium acetate solution and treated with triethylamine (50 ml) at reflux. The cooled reaction mixture was washed well with water to remove triethylamine and triethylamine hydrobromide and then the toluene was removed under reduced pressure. The product, 1,5-pentamethylene diacrylate (24.0 g, 75% yield) was obtained as a pale liquid by high vacuum distillation (b.p. 90-95 C./0.1 mm Hg).
With hydrogen;Cu-Zn composite oxide catalyst; at 275℃; under 187519 Torr; for 1.5h;Product distribution / selectivity;
Step 9: Hydrogenation of esterified product 1200 g of the esterified product in Step 7 and 12 g of the catalyst prereduced in Step 8 were placed in an autoclave made of stainless steel. Hydrogenation reaction was carried out at 275C for 1.5 hours while supplying hydrogen so that the pressure was 25 MPa. After the reaction, the catalyst was filtered to obtain 1220 g of a filtrate. The SV conversion rate of the filtrate was 86.6%. The filtration rate according to the filterability test was 102 seconds
poly(1,4-cyclohexanedimethanol-co-2,2-dimethoxypropane-co-1,5-pentanediol)[ No CAS ]
Yield
Reaction Conditions
Operation in experiment
Stage #1: 1 ,5-pentanediol; bis-1,4-(hydroxymethyl)cyclohexane With toluene-4-sulfonic acid In ethyl acetate; benzene at 100℃;
Stage #2: 2,2-dimethoxy-propane In benzene for 24h;
Stage #3: With triethylamine In benzene
8
Polyketal copolymers were synthesized in a 25 mL two-necked flask, connected to a short-path distilling head. The diols, 1 ,4-cyclohexanedimethanol (1.04 g, 7.25 mmol) and, either 1,4-butanediol, 1,5-pentanediol, 1 ,6-hexanediol, or 1,8-octanediol were dissolved in 20 mL of distilled benzene and kept at 100°C. Re-crystallized p- toluenesulfonic acid (5.5 mg, 0.029 mmol), dissolved in 550 μL of ethyl acetate, was added to the benzene solution. The ethyl acetate was distilled off, and distilled 2,2- dimethoxypropane (equal molar quantity as the two diols combined) was added to initiate the reaction. Additional doses of 2,2-dimethoxypropane (500 μL) and benzene (2 mL) were subsequently added to the reaction, every hour for 6 hours, via a metering funnel, to compensate for 2,2-dimethoxypropane and benzene that had distilled off. After 24 hours, the reaction was stopped by adding 100 μL of triethylamine. The polymer was isolated by precipitation into cold hexanes and analyzed by 1H-NMR and GPC, in general the resulting polymers had number average molecular weights between 2000 to 4000 Da. Table 1 lists the compositions and molecular weights of the polyketal copolymers synthesized. 1H NMR spectra were obtained using a Varian Mercury VX 400 MHz NMR spectrometer (Palo Alto, CA) using CDCl3 as the solvent, the H-NMR spectra of the polyketal copolymers are summarized below, as a representative example, the 1H- NMR of PK3 is shown in Figure 50. The molar ratio of 1,5-pentanediol to 1,4- cyclohexanedimethanol was obtained by obtaining the ratio of areas under the peaks a and b, respectively.PKl. 1H NMR (CDCl3) δ = 3.4 - 3.18 (m, 4H), 1.66 (s, 1.9H), 1.85 - 0.93 (m, 8H), and 1.32 (s, 6H)
Stage #1: 1 ,5-pentanediol With sodium at 100℃; for 1h;
Stage #2: 4-chloro-2,3-dimethylpyridine-N-oxide at 120℃; for 2h;
1
Under a nitrogen stream and in a silicone oil bath, 140 mL of 1,5-pentanediol was introduced, and while stirring, 4.6 g (0.2 mol, 2.0 eq.) of metallic sodium (Na) was added. Subsequently, the silicone oil bath was heated, and the mixture was allowed to react at 100°C for 1 hour. To the obtained reaction liquor, 15.8 g (1.0 mol, 1.0 eq.) of 4-chloro-2, 3-dimethylpyri dien-N-oxide was added, and then the mixture was allowed to react at an elevated temperature of 120°C for 2 hours. The reaction liquor was cooled, and then concentrated under reduced pressure and dried to solid, to obtain 53.3 g of concentrated residue, and the concentrated residue was purified using a silica gel column to obtain 25.0 g of 4- (5-hydroxypentyloxy) -2, 3-dimethylp yridine-N-oxide.
With sodium hydroxide In tetrahydrofuran; water at 20 - 25℃; for 3h;
66%
With sodium hydroxide In tetrahydrofuran; water at 5℃; for 0.5h;
59%
With sodium hydroxide In tetrahydrofuran for 0.5h;
32.4%
With sodium hydroxide In tetrahydrofuran; water at 20℃; for 3h;
3 Example 3: Synthesis of aurovertin B derivative AUB-1 (the synthetic route is shown in formula 1)
Weigh the compound described in formula II (144mg, 0.39mmol) in a round bottom flask, add 4mL THF, select a moderate stirring magnet, stir on a stirrer to dissolve, add 0.4mL NaOH aqueous solution (36.8 mg, 0.92mmol) ), and add 1,5-pentanediol (0.63mmol), react at room temperature for 3h, TLC monitors the progress of the reaction during the process, when the raw materials are completely converted, add 4mL distilled water to terminate the reaction, the reaction solution is extracted three times with 5mL ethyl acetate, After separation, the organic layer was spin-dried and subjected to silica gel column chromatography (200 mesh-300 mesh). The eluent was petroleum ether: acetone = 3.5:1, and thin-layer silica gel was used for detection. The eluent with strong ultraviolet absorption spots under the lamp was evaporated under reduced pressure to obtain the target product IIIb (41.4 mg). The separation yield was calculated as 32.4% according to formula II.
With sodium hydroxide In tetrahydrofuran; water at 20℃;
With sodium hydroxide In tetrahydrofuran at 20℃; for 2h;
With sodium hydroxide In tetrahydrofuran at 20℃; for 2h;
at 0℃; for 0.5h; Alkaline conditions;
With sodium hydroxide In tetrahydrofuran at 20℃; for 0.666667h;
With sodium hydroxide In tetrahydrofuran Inert atmosphere;
E. coli strain MBX3017 harboring orfZ-dhaT-pduP genes;Microbiological reaction;
Example 13Biosynthesis of 1,5-Pentanediol from Sodium 5-hydroxyvalerateStrain ConstructionStrain MBX3017 (LS5218 DeltaadhE::FRT, DeltaldhA::FRT, DeltaackA-pta::FRT) and K-12 strain MG1655 were used as a host strain to assess if 1,5-pentanediol (PDO) could be accumulated and secreted into the medium. Each single deletion strain was constructed by the Red/ET method from Gene Bridges. Primers for constructing knock-out cassettes for the three pathways are listed in Table 14. Briefly, the following primers were used for the construction of the various chromosomal deletions: MS286 and MS287 for the DeltaadhE cassette; MS289 and MS290 for the DeltaackA-pla cassette; and MS292 and MS293 for the DeltaldhA cassette. The LS5218 DeltaadhE::FRT, DeltaldhA::FRT, DeltaackA-pta::FRT was obtained by iteratively P1 transducing each single null mutation into LS5218 and removing the marker as described in an earlier example. TABLE 14 Primer used for PDO studies Primer Sequence (5' ? 3') Comment MS286 CGGTTTATGTTGCCAGACAGCGCTACTGATTAAGCGGATTTT DeltaadhE cassette TTCGCTTTCATATGAATATCCTCCTTAGT (SEQ ID NO: 44) MS287 CGAGCAGATGATTTACTAAAAAAGTTTAACATTATCAGGAG DeltaadhE cassette AGCATTATGGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 45) MS289 TGGCTCCCTGACGTTTTTTTAGCCACGTATCAATTATAGGTA DeltaackA-pta CTTCCATGGTGTAGGCTGGAGCTGCTTC cassette (SEQ ID NO: 46) MS290 GCAGCGCAAAGCTGCGGATGATGACGAGATTACTGCTCCTG DeltaackA-pta TGCAGACTGCATATGAATATCCTCCTTAGT cassette (SEQ ID NO: 47) MS292 CTCCCCTGGAATGCAGGGGAGCGGCAAGATTAAACCAGTTC DeltaldhA cassette GTTCGGGCACATATGAATATCCTCCTTAGT (SEQ ID NO: 48) MS293 TATTTTTAGTAGCTTAAATGTGATTCAACATCACTGGAGAA DeltaldhA cassette AGTCTTATGGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 49) FS011 TCCCCTAGGATTCAGGAGGTTTTTATGGAGTGGGAAGAGAT 5' of orfZ ATATAAAG (SEQ ID NO: 50) FS008 CCTTAAGTCGACAAATTCTAAAATCTCTTTTTAAATTC 3' of orfZ (SEQ ID NO: 51) JRG047 TTCAGGATCCTGCGCATGCTAGCTATAGTTCTAGAGGTA 5' of pduP (SEQ ID NO: 52) JRG048 CATACGATAGCTCATAAAAACCTCCTCGCAGTTAGCGAATA 3' of pduP GAAAAGCCGTTGG (SEQ ID NO: 53) JRG049 GAGGAGGTTTTTATGAGCTATCGTATGAGCTATCGTATGTTT 5' of dhaT GATTATCTGGTGC (SEQ ID NO: 54) JRG050 TCTTTCATGAACTCAGAATGCCTGGCGGAAAATCG 3' of dhaT (SEQ ID NO: 55) The CoA-dependent propionaldehyde dehydrogenase encoding pduP from S. typhimurium (see Table 1A; Leal, Arch. Microbiol. 180:353-361 (2003)) was amplified by primers JRG47 and JRG4S. The 1,3-propanediol dehydrogenase encoding dhaT from Klebsiella pneumoniae (see Table 1A; Tong et al., Appl. Environ. Microbiol. 57(12):3541-3546 (1991)) was amplified with primers JRG49 and JRG50. The two genes were fused together by SOE-PCR using primers JRG47 and JRG50. The resulting DNA fragment was cloned into pJB78 via BamHI and BspHI sites, and the resulting plasmid was designated as pJG10.Strain MBX3017 or MG1655 harboring pFS16 or pSE380 and pJG10 or pJB78 were used for PDO studies.Strains were grown under oxygen limited conditions in 5HV-containing E2 medium for 40 h. The medium consisted of: 10 g/L glucose, 2 g/L 5HV, 26 mM NaNH4HPO4, 33 mM K2HPO4, 27 mM KH2PO4, 2 mM MgSO4, 25 mug/mL chloramphenicol, 100 mug/mL ampicillin, 0.1 mM IPTG, and trace elements as described above. Overnight cultures were inoculated into a sealed culture tube containing fresh medium to a final OD600 of approximately 0.2, the headspace for the culture tube was small to ensure oxygen limitation of the culture. The cultures were incubated at 30 C. Amer 48 h of incubation, 100 mul, sample was removed, centrifuged, and the resulting supernatant was spiked with 1,4-butanediol (0.1 mu/L) as internal standard, dried in a Labconco centrivap and resuspended in 100 muL acetonitrile (ACN) by sonication for 3 h. The acetonitrile solution was centrifuged to remove insoluble material, and the supernatant was injected into an Agilent 5975 GC-MS equipped with a DB-225 ms column using the following acquisition parameters: carrier gas Helium flow rate 1 ml/min, scan mode m/z 30-400, oven program: 40 C. for 2 min, then ramp up to 220 C. at 10 C./min, ion source temperature 230 C., the quadrupole mass filter temperature 150 C.The measured PDO results are shown in Table 14. The combination of host strain MBX3017 and overexpression of orfZ-dhaT-pduP gave the highest PDO yield of 0.32 g/L. Strain MG1655 harboring these three genes gave a lower yield of 0.22 g/L, possibly due to its active ethanol, acetate and lactate pathway, which are known electron acceptors (Clark, FEMS Microbiol. Rev. 5:223-34 (1989)) and could compete with the 5HV pathway for NAD(P)H. Interestingly, MG1655 harboring just orfZ also produced small amounts of PDO, while the MBX3017 host did not yield any detectable PDO (Table 15). This indicates that a endogenous alcohol dehydrogenase, e.g. adhE, has weak activity towards 5HV-CoA. The measured PDO was confirmed by GC-MS against the PDO standard and NIST library PDO reference spectrum as shown in FIG. 8. These results demonstrate that PDO can be produced from Na5HV when the orfZ gene is expressed to generate 5HV-CoA and the pduP-...
toluene-4-sulfonic acid; at 90 - 100℃;Inert atmosphere;
A mixture of 1, 5-Pentane diol (1 kg), methyl acrylate (lOLit) and p-toluenesulfonic acid in a 20 lit reactor was heated to 90-1000C with stirring under nitrogen atmosphere. Further methyl acrylate (7 lit) was added drop by drop while a mixture of methyl acrylate and methanol are distilled at the same temperature for 6 to 8 hrs. Progress of the reaction is monitored by TLC.After completion of the reaction, the excess methyl acrylate was distilled out completely under vacuum. The reaction mixture was cooled to room temperature, diluted with pet ether (1OL it), and the mixture washed once with aqueous 5% sodium bi carbonate followed by brine. The pet ether from the extract was distilled out, followed by high vacuum distillation of the product at less than lmm of Hg at 130- 1400C to yield pure 1, 5-Penatanediol diacrylate (1 kg)
With 2,4,6-trimethyl-pyridine; (2S,5S)-2,5-bis[[(2S)-3-(1H-indol-3-yl)-1-(octyloxy)-1-oxopropan-2-ylamino]carbonyl]-1-(pyridin-4-yl)pyrrolidine In chloroform at -60℃; for 48h; chemoselective reaction;
With carbon dioxide; Rh/Al2O3; hydrogen; at 80℃; for 24h;Autoclave;
In this example, screening of the catalyst was carried out. 0.1 g of a catalyst and 0.4 g of tetrahydrofurfuryl alcohol were introduced into a 50 mL stainless steel autoclave, 1 MPa of carbon dioxide was introduced, and then heated to 80 C. Thereafter, hydrogen was introduced for 4 MPa, and finally, carbon dioxide was introduced with a pump to a total of 14 MPa (the total pressure was 18 MPa)After reacting for 24 hours, it was cooled with ice, sufficiently cooled, and pressure was gradually withdrawn. Finally, the reactants remaining in the autoclave were all washed out with acetone, the catalyst was filtered, and the obtained product was measured by gas chromatography or gas chromatography mass spectrometer. The results are shown in Table 1
With ammonia In toluene at 180℃; for 12h; Autoclave; Inert atmosphere;
2
Catalyst complex XIVb (for preparation, see below, weighed out under an inert atmosphere), solvent (such an amount that the total solvent volume is 50 ml) and the alcohol to be reacted were placed under an argon atmosphere in a 160 ml Parr autoclave (stainless steel V4A) having a magnetically coupled inclined blade stirrer (stirring speed: 200-500 revolutions/minute). The indicated amount of ammonia was introduced at room temperature either in precondensed form or directly from the pressurized NH3 gas bottle. If hydrogen was used, this was effected by iterative differential pressure metering. The steel autoclave was electrically heated to the temperature indicated and heated for the time indicated while stirring (500 revolutions/minute) (internal temperature measurement). After cooling to room temperature, venting the autoclave and outgassing the ammonia at atmospheric pressure, the reaction mixture was analyzed by GC (30m RTX5 amine 0.32 mm 1.5 μm). Purification of the particular products can, for example, be carried out by distillation. The results for the amination of 1,4-butanediol (table 1a, 1b), diethylene glycol (table 2) and monoethylene glycol (table 3), 2,5-furandimethanol (table 4), alkyldiols (table 5), 1,4-bis(hydroxymethyl)-cyclohexane (table 6) and aminoalcohols (table 7) are given below.
With chlorocarbonylhydrido[4,5-bis(dicyclohexylphosphinomethyl)acridine]ruthenium(II); ammonia In toluene at 180℃; for 12h; Autoclave; Inert atmosphere;
General procedure: Example General Rules on the catalyst amination of alcohol with ammoniaaccording to the present invention (See below for manufacturing, initialweighed under an inert atmosphere) catalyst complex XIVb and, with the solvent(amount of up to solvent total amount reaches the 50ml), and the alcohol thatthe reaction is, under an argon atmosphere, magnetic coupling type tilt wingsParr autoclave of 160ml equipped with a stirrer (made of special steel V4A)(stirring speed: 200 to 500 rev / min) were charged in. At described the amountof ammonia at room temperature, it has been directly metered from thepreliminary condensed with or NH 3 gas cylinder. If hydrogen is used, this wasdone by repeated differential-pressure volume. Steel autoclave is electricheating heated to the temperature indicated, for a period of time described, ithas been heated under stirring (500 rev / min) (internal temperaturemeasurement). The autoclave was cooled to room temperature, depressurized,after performing outgassing of ammonia at atmospheric pressure, the reactionmixture was analyzed by GC (30m RTX5 Amin 0.32mm, 1.5μm). The desired product,for example, can be isolated by distillation
With platinum on carbon; oxygen; acetic acid; In water; at 69.84℃; under 7500.75 Torr;pH 2.5;Catalytic behavior;
General procedure: The semi-batch aqueous alcohol oxidation reactions were performed in a 50 cm3 Parr Instrument Company 4592 batch reactor with a 30 cm3 glass liner. The appropriate amounts of substrate, acid (to control pH), and catalyst were added to approximately 10 cm3 of distilled, deionized water in the glass liner. The glass liner was inserted into the reactor, sealed, purged with He, and heated to 343 K. The reaction was initiated by pressurizing the reactor with 10 bar absolute O2 (GT&S, 99.993%). The pressure was maintained at a constant value by continually feeding O2. No conversion was observed after 240 min when N2 was substituted for O2. Samples were periodically removed and the catalyst was filtered using 0.2 mum PTFE filters before analysis with a Waters e2695 high pressure liquid chromatograph (HPLC). The HPLC was equipped with refractive index and UV/Vis detectors. Product separation in the HPLC was carried out with a Aminex HPX-87H column (Bio-Rad) operating at 318 K with 5 mM H2SO4 in water flowing at 5 cm3min-1. Carbon balances were always greater than 90% except when specifically mentioned in the text. The retention times and calibration curves were determined by injecting known concentrations of standards. The pH of the samples was determined by a Orien 3-Star Plus pH Portable Meter with a Thermo Orion 9810BN Micro-pH Electrode after the sample had cooled to room temperature.
With Oxone; 2-iodo-3,4,5,6-tetramethylbenzoic acid; In water; acetonitrile; at 60℃; for 24.0h;Green chemistry;
General procedure: In a typical experiment, a round bottom flask containing 4-6mL of acetonitrile/water mixture (1:1) was charged with 0.5-1.0mmol of the diol, 5mol% of TetMe-IA, and oxone (2equiv). The resulting mixture was stirred at rt for benzylic diols and at 45C for aliphatic diols. At the end of the reaction, as judged from TLC analysis, little water was added to dissolve the inorganic salts, and the organic matter was extracted with EtOAc at least two times. The combined extract was dried over anhydrous Na2SO4, concentrated in vacuo to obtain the crude product, which was subjected to silica-gel column chromatography using ethyl acetate/pet ether to isolate the pure product.
With 5% Pd/C; hydrogen; In isopropyl alcohol; at 219.84℃; under 25858.1 Torr; for 40h;Inert atmosphere;
Continuous hydrogenation of furfural was carried out in a bench scale, high- pressure, fixed-bed reactor supplied by M/s Geomechanique, France. This reactor set up consisted of a stainless steel single tube of 0.34 m length and 1.5 x 10-2 m inner diameter. The reactor was heated by two tubular furnaces whose zones (TIC1 and TIC2) were independently controlled at the desired bed temperature. The reactor was provided with mass flow controllers, pressure indicator, and controller (PIC) devices and two thermocouples to measure the temperature at two different points. A storage tank was connected to the HPLC pump through a volumetric burette to measure the liquid flow rate. The pump had a maximum capacity of 3 x 10-4 m3/h under a pressure of 100 bar. The gas-liquid separator was connected to other end of the reactor through a condenser. Ten gm of the powder catalyst was charged in to the reactor. The section of 7 x 10-2 m above and 7 x 10-2 m below the catalyst bed was packed with carborandum as an inert packing, and remaining reactor was filled with catalyst powder in four sections, where the sections are separated by carborandoms. Before starting the actual experiment the reactor was flushed thoroughly, first with N2 and then with H2 at room temperature. Then the reactor was pressurized with H2 after attaining the desired temperature. The liquid feed was "switched on" after the reactor reached the operating pressure and was kept at that value for 1 h to obtain the constant liquid flow rate. Liquid samples were withdrawn from time to time. Samples taken during the reaction were analyzed with a Trace GC 700 series GC System (Thermo SCINTIFIC) coupled with FID detector and capillary column (HP-5 capillary column, 30 m length X 0.32 mm id). The following temperature programme method was used for GC analysis: 40 C (3 min)-lC/min-45 C (1 min) -10C/min-60(0 min) -20C/min-250(1 min). Following this procedure, the experiments were carried out at different inlet conditions of liquid and gas flow rates. The reactor was operated in the temperature and pressure ranges of 423-513 K and 20-50 bar, respectively. Steady-state performance of the reactor was observed by analysis of the reactant and products in the exit stream. The conversion and selectivity were calculated and defined as follows; As mentioned above, 3% Pd/C catalyst gives highest selectivity to THF in the batch operation; hence the same catalyst is taken for the continuous process. The continuous hydrogenation reaction was carried out at 493 K temperature and 500 psi H2 pressure. The conversion of FFR was remains 100% as in the continuous process and the THF selectivity was increased from 20% to 41% as compared to batch process and the other ring hydrogenated product were 42% (THFAL 36%, MTHF 7%), the results are shown in fig. 7. Initially the selectivity was 20% at 10 hrs, after 40 hrs the selectivity of THF was 41% and it remains constant up to 74 hrs. The increase in selectivity of THF (41%) is due to lower the contact time of substrate to catalyst as compare to batch process.
With platinum(IV) oxide; hydrogen; In ethanol; at 50℃; under 1500.15 Torr; for 5h;Autoclave;
[18] An exception was the catalyst Pt-JA-023. Owing to its low activity, hydrogen pressure and reaction temperature were increased to up to 180 C. and 60 bar during the reaction. The experimental results are summarized in Table 23. With the exception of Pt-JA-023, all catalysts achieved high conversions of over 96% within a reaction time of 2-5 h. A broad product spectrum consisting of 1,2-PD, 1,5-PD, THFFOH, 1-POH, 2-MF, 2-MTHF and also further unknown by-products was obtained. This roughly agrees with the reaction products previously reported. [21] Compared to the supported catalysts (Table 11), a significantly higher ratio of 1,5-PD to 1,2-PD was obtained. In the case of the Pt(IV) oxide catalyst from Heraeus, even more 1,5-PD (23% selectivity) than 1,2-PD was formed. The highest selectivity to 1,2-pentanediol of 25% was achieved by the Pt(IV) oxide catalyst from Sigma Aldrich. It is conspicuous that the calculated balance E is significantly below 100% for all catalysts tested. This can presumably be attributed to production of large amounts of unknown by-products for which no GC calibration data were available.
40.2%Chromat.; 21.3%Chromat.; 36.5%Chromat.
With hydrogen; In ethanol; at 150℃; for 4h;
0.1 g of [Pt(0)/HT] (platinum: 0.01 mmol) obtained in Preparation Example 1, furfural (registered trademark) 1 mmol, 2-propanol (2-PrOH) 3.0 mL was added and stirred under a hydrogen atmosphere (30 atm) at 150 C. for 4 hours to obtain 1,2-pentanediol (conversion: 100% : 72.6%, yield: 72.6%). Incidentally, conversion and yield were measured by GC-MS by a standard measurement method.
With platinum(IV) oxide; hydrogen; In ethanol; at 180℃; under 15001.5 - 45004.5 Torr; for 2h;Autoclave;
[18] An exception was the catalyst Pt-JA-023. Owing to its low activity, hydrogen pressure and reaction temperature were increased to up to 180 C. and 60 bar during the reaction. The experimental results are summarized in Table 23. With the exception of Pt-JA-023, all catalysts achieved high conversions of over 96% within a reaction time of 2-5 h. A broad product spectrum consisting of 1,2-PD, 1,5-PD, THFFOH, 1-POH, 2-MF, 2-MTHF and also further unknown by-products was obtained. This roughly agrees with the reaction products previously reported. [21] Compared to the supported catalysts (Table 11), a significantly higher ratio of 1,5-PD to 1,2-PD was obtained. In the case of the Pt(IV) oxide catalyst from Heraeus, even more 1,5-PD (23% selectivity) than 1,2-PD was formed. The highest selectivity to 1,2-pentanediol of 25% was achieved by the Pt(IV) oxide catalyst from Sigma Aldrich. It is conspicuous that the calculated balance E is significantly below 100% for all catalysts tested. This can presumably be attributed to production of large amounts of unknown by-products for which no GC calibration data were available.
With iron(III) chloride hexahydrate; In tetrachloromethane; at 160 - 180℃;Autoclave; Inert atmosphere;
General procedure: The reactions were carried out ina glass ampoule (V = 10 mL), placed in a stainless-steel micro autoclaves (V = 17 mL) underconstant stirring and controlled heating.The ampoule was charged with FeCl3·6H2O (2.9 mg, 0.01 mmol), niline (0.2 mL, 2.15 mmol),diol (1,4-butanediol 0.38 mL and 1,5-pentanediol 0.45 mL, 4.30 mmol ) and carbon tetrachloride(0.06 mL, 0.65 mmol) in an argon flow. The sealed ampoule was placed in an autoclave. Theautoclave was air-tightly closed and heated at 160-180 for 6-12 h under continuous stirring.After completion of the reaction, the autoclave was cooled to room temperature, the ampoulewas opened, and the reaction mixture was treated with diluted (10percent) hydrochloric acid. Thewater layer was separated, neutralized with 10percent solution of sodium hydroxide, and extractedwith dichloromethane. The organic layer was filtered and the solvent was distilled off. Theresidue was distilled in a vacuum or recrystallized from hexane.
1,5-bis[N-(p-ethylphenyllyl)carbamoyloxy]pentane[ No CAS ]
Yield
Reaction Conditions
Operation in experiment
92%
In toluene for 24h; Reflux;
2 General procedure for the synthesis of bis[N-(p-aryl)-carbamoyloxy]alkanes
General procedure: p-Aryl isocyanates were prepared according to already described procedure64,65 and identified by their IR spectra (2259-2275cm-1). Bis[N-(p-aryl)-carbamoyloxy]alkanes were synthesized by the reaction of diols (1,3-propanediol, 1,4-butanediol, 1,5-pentanediol, and 1,6-hexanediol) and p-aryl isocyanates in toluene. In a 100 ml round-bottom flask, fitted with a reflux condenser, p-aryl isocyanate (2.3equiv) and the corresponding diol (1equiv) were mixed in toluene. The mixture was refluxed for 24h. At the end of this period, toluene was removed by rotary evaporation. The solid residue was purified by recrystallization from absolute ethanol and subsequent filtration followed by drying under vacuum resulted in bis[N-(p-aryl)-carbamoyloxy]alkanes as white solids.
With 2,2,2-trifluoroethanol; chloro-(pentamethylcyclopentadienyl)-{5-methoxy-2-{1-[(4-methoxyphenyl)imino-N]ethyl}phenyl-C}-iridium(lll); potassium carbonate at 100℃; for 24h; Inert atmosphere; Sealed tube;
Step 1. Synthesis of 2: To a solution of 1 ( 1 g, 2.33mmol) in mixture of dichloromethane (10ml) and dimethylformamide (1 ml) was added N,N~ dicyclohexylcarbodiimide (0.627g, 3,Q41mmol) followed by N- I iydroxvbenzatriazole (0.316g, 2.33mmol) slowly at ice cold condition and stirred at RT for 2h to obtain turbid suspension. To this turbid solution pentanediol (0.85ml, 8.1 8mmol) was added followed by 4-dimethylaminopyridine (0.284g, 2.33mmol). The final reaction mixture was stirred at RT for 16h. The white precipitate was filtered and extracted with ethyl acetate. The filtrate was washed with brine solution, dried over sodium sulphate and evaporated to get crude mass. 1 1 7 The cmde product was purified by flash column chromatography eluting with 1% methanol/ dichloromethane to obtain pure compound, 2 (0.9g, 80% yield).
With hydrogen; In ethanol; at 139.84℃; under 45004.5 Torr; for 0.5h;Autoclave;
General procedure: The FFA hydrogenolysis reactions were carried out in astainless steel autoclave reactor (100 mL) at a stirring speed of800 r/min. Prior to each reaction, the calcined catalyst samplewas reduced at 623 K in 20% H2-80% N2 at a flow of 40mL/min for 3 h. In a typical trial, 40 g of 10 wt% FFA dissolvedin ethanol was added into reactor together with a quantity ofthe reduced catalyst. After flushing with H2, the reactor waspressurized with H2 to 6.0 MPa, and then heated to 413 K overthe course of 0.5 h. The concentrations of the reactant and liquidproducts were analyzed by gas chromatography (Agilent7890A GC) with a PONA capillary column (50 m × 0.20 mm ×0.50 mum). Products were also identified using an Agilent7890A/5975C gas chromatograph-mass spectrometer (GC-MS)with an HP-5MS column. The liquid products identified in thismanner consisted of 1,2-PeD, 1,5-PeD, 1,4-pentanediol,2-methyl furan (2-MF), 2-methyl tetrahydrofuran (2-MTHF),1-pentanol, 2-pentanol, n-pentane and tetrahydrofurfuryl alcohol(THFA). FFA conversions and product selectivities werecalculated on the basis of the following equations.Conversion (%) = (moles of FFA charged - moles ofFFA left)/moles of FFA charged 100%Selectivity (%) = moles of a product generated/(moles of FFA charged - moles of FFA left) 100%
With hydrogen; In ethanol; at 139.84℃; under 45004.5 Torr; for 0.5h;Autoclave;
General procedure: The FFA hydrogenolysis reactions were carried out in astainless steel autoclave reactor (100 mL) at a stirring speed of800 r/min. Prior to each reaction, the calcined catalyst samplewas reduced at 623 K in 20% H2-80% N2 at a flow of 40mL/min for 3 h. In a typical trial, 40 g of 10 wt% FFA dissolvedin ethanol was added into reactor together with a quantity ofthe reduced catalyst. After flushing with H2, the reactor waspressurized with H2 to 6.0 MPa, and then heated to 413 K overthe course of 0.5 h. The concentrations of the reactant and liquidproducts were analyzed by gas chromatography (Agilent7890A GC) with a PONA capillary column (50 m × 0.20 mm ×0.50 mum). Products were also identified using an Agilent7890A/5975C gas chromatograph-mass spectrometer (GC-MS)with an HP-5MS column. The liquid products identified in thismanner consisted of 1,2-PeD, 1,5-PeD, 1,4-pentanediol,2-methyl furan (2-MF), 2-methyl tetrahydrofuran (2-MTHF),1-pentanol, 2-pentanol, n-pentane and tetrahydrofurfuryl alcohol(THFA). FFA conversions and product selectivities werecalculated on the basis of the following equations.Conversion (%) = (moles of FFA charged - moles ofFFA left)/moles of FFA charged 100%Selectivity (%) = moles of a product generated/(moles of FFA charged - moles of FFA left) 100%
6-(5-hydroxypentyl-oxy)pyridine-3-carbonitrile[ No CAS ]
Yield
Reaction Conditions
Operation in experiment
67.02%
Stage #1: 1 ,5-pentanediol With sodium hydride In N,N-dimethyl-formamide at 0℃; for 0.25h;
Stage #2: 6-chloronicotinonitrile In N,N-dimethyl-formamide at 0℃; for 3h;
2.1 Step 1
To a stirred suspension of NaH (0.28 g, 7.21 mmol, 2.0 eq.) in DMF (6 mL) was added pentane- 1, 5 -diol (0.37 g, 3.62 mmol, 1 eq.) at 0°C. The reaction mixture was allowed to stir at 0°C for 15 minutes. Then 6-chloronicotinonotrile (0.35 g, 2.52 mmol, 1 eq.) was added to the reaction mixture. The reaction mixture was stirred at 0°C for 3 h. Progress of reaction was monitored by TLC and LCMS. After the consumption of starting material, the reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (3 x 50 mL). The separated organic layer was dried over anhydrous NaiSCL and concentrated under reduced pressure to get crude product. The crude product was purified by Combi-Flash chromatography to afford 6-((5- hydroxypentyl) oxy) nicotinonitrile (0.50 g, 67.02 %) which was used in the next step. (0343) Analytical data (0344) LCMS: 207 [M+l] +
63%
Stage #1: 1 ,5-pentanediol With sodium hydride In N,N-dimethyl-formamide at 0℃; for 0.5h; Inert atmosphere;
Stage #2: 6-chloronicotinonitrile In N,N-dimethyl-formamide at 0℃; for 2h;
74.74C Embodiment 74C 6-(5-hydroxwentyl-oxy)-pyridine-3-carbonitrile
Under the protection of N2 gas at 0° C., add sodium hydride (8.7 g, 216.5 mmol, 60%) in batch into the solution of Embodiment 1,5-pentanediol (11.3 g, 108.3 mmol) in N,N-dimethylformamide (50 ml). Agitate the reaction solution 0.5 hour at 0° C. Then add the solution of 2-chloro-5-cyano-pyridine (5 g, 36.1 mmol) in N,N-dimethylformamide (20 ml). Then agitate it 2 hours at 0° C. Add water to quench the reaction. Then extract it with ethyl acetate (100 ml×3) and dry the combined organic layer with Na2SO4 before filter and evaporate. Then purify the residue with column chromatography to obtain the title compound (4.7 g, yield of 63%). 1H NMR(400 MHz,CDCl3)68.49(d,J=2.0 Hz,1H),7.78(dd,J=2.3,8.5 Hz,1H), 6.81(d,J=8.5 Hz,1H),4.46-4.33(m,2H),3.79-3.61(m,2H),1.84(quin,J=7.2 Hz,2H),1.71-1.45(m,4H). LCMS(ESI)m/z:207(M+1).
With hydrogen; In isopropyl alcohol; at 150℃; for 4h;
0.1 g of [Pt(0)/HT] (platinum: 0.01 mmol) obtained in Preparation Example 1, furfural (registered trademark) 1 mmol, 2-propanol (2-PrOH) 3.0 mL was added and stirred under a hydrogen atmosphere (30 atm) at 150 C. for 4 hours to obtain 1,2-pentanediol (conversion: 100% : 72.6%, yield: 72.6%). Incidentally, conversion and yield were measured by GC-MS by a standard measurement method.
With ammonium nitrate; ammonia; In dichloromethane; at -5 - 0℃; for 5h;
(1) According to the quality of ice: ammonium nitrate = 100: 10 preparation of ice salt,At a molar ratio of 1: 0.5: 2.5 to take trimellitic anhydride,1,5-pentanediol,Ammonia (28 wt%),Solvent methylene chloride is 8 times the volume of the reactants;The tocharged <strong>[1204-28-0]trimellitic anhydride acid chloride</strong> was charged into solvent methylene chloride,Start magnetic stirrer,First, trimellitic anhydride chloride was dissolved in dichloromethane,The weighed 1,5-pentanediol was then placed in a dropping tube,15min slowly dripping finished,To obtain a reaction solution;The ammonia solution is put into the reaction solution,And then to the water bath to add ice salt control reaction temperature of -5 ~ 0 ,Reaction 5h,The resulting solution was white,Is the crude product of 1,5-diphenyl trimellitate; (2) The crude product was supplemented with distilled water and 1,5-pentanediol,Shake,filter,Removing the ammonium chloride in the aqueous layer and the remaining trimellitic anhydride chloride in dichloromethane,And unsubstituted complete 1,5-pentanediol esters;then,The resulting residual paste solids were added to 50 ml of ethyl acetate and 50 ml of 1,5-pentanediol,The resulting mixture was slowly poured into saturated sodium carbonate,Standing,The precipitated solid is pure 1,5-diphenyl trimellitate.The present example was subjected to a dopant treatment to obtain a pure white solid,Is 1,5-diphenyl trimellitate,Dried in a vacuum oven to constant weight,The yield was 83.2%.
With hydrogen; In ethanol; at 139.84℃; under 45004.5 Torr; for 2h;Autoclave;
The selective hydrogenolysis of FFA was carried out in a 100mL stainless steel autoclave at a stirring speed of 800 r/min. Allthe calcined samples were used in the powder form. Prior toeach test, the calcined samples with a granule size of 60-80mesh were pre-reduced in 5%H2-95%N2 flow (40 mL/min) at573 K for 3 h. In a typical run, 30 g of 5 wt% FFA in ethanolsolution together with the pre-reduced catalyst were introducedinto the autoclave. After purging thrice with H2, the reactorwas pressurized to 6 MPa and heated to 413 K to start thereaction. For comparison, the hydrogenolysis of THFA was alsostudied over the 10Cu-LaCoO3 catalyst using similar conditions.After centrifugation, the products were identified using an Agilent 7890A/5975C gas chromatograph-mass spectrometer(GC-MS) with an HP-5MS column. The reactant and liquidproducts were analyzed by gas chromatography (Agilent7890A GC) with a PONA capillary column (50 m × 0.20 mm ×0.50 mum) and a flame ionization detector (FID).
Stage #1: 1 ,5-pentanediol With sodium hydride In N,N-dimethyl-formamide; mineral oil at 0℃; for 0.5h;
Stage #2: benzyl bromide In N,N-dimethyl-formamide; mineral oil at 0 - 50℃; for 2.5h;
7 Step 7. 4-(l3enzyloxy)butan-1-ol
To a solution of 5-(benzyloxy)pentan-1-ol (50 g,0.56 mol) in DMF (400 ml) was added NaH (17.7 g, 0.44 mol) in batches at 0° C. After stirring for 30 minutes, 13n13r (66 g, 0.39 mol) was added dropwise at 00 C. The resulting suspension was stirred at 20° C. for 30 minutes. Then it was heated to 50° C. for another 2 hours. The reaction was quenched with water (500 mE) and extracted with of EA (1 E). The organic phase was washed with brine. The combined organic layers were dried over anhydrous Na2504. The solvent was removed under vacuum to afford crude desired product 4-(benzyloxy)butan-1-ol (60 g crude, 100% yield),which was used in next step directly. ‘H NMR: (400 MHz, DMSO): ö 7.28-7.35 (m,5H), 4.46 (s, 2H), 4.21 (t, J=6.8 Hz, 2H), 3.46 (t, J=6.8 Hz,2H), 3.15 (s, 3H), 1.61-1.76 (m, 4H). Chemical Formula: C, ,H, 5°2; Molecular Weight:180.24 Total H count from ‘HNMR data: 18
6-((5-hydroxypentyl)oxy)benzo[d]isothiazol-3(2H)-one 1,1-dioxide[ No CAS ]
Yield
Reaction Conditions
Operation in experiment
To a solution of pentane-1,5-diol (1.73 g, 16.7 mmol) in N,N-dimethylformamide (15.0 mE) was added sodium hydride (266 mg, 6.66 mmol) under nitrogen. The reaction mixture was stirred at room temperature for 1 h. Then <strong>[22952-24-5]6-nitrobenzo[d]isothiazol-3(2H)-one 1,1-dioxide</strong> (760 mg, 3.33 mmol) was added and stirred at 700 C. for 12 hours. After cooling to room temperature, the solvent was removed in vacuo. The residue was extracted with ethyl acetate (30 mLx3) and water (30 mE). The organic layer was washed with brine (5 mE). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated in vacuo. The residue was washed by methanol (3 mE) to give 6-((5-hydroxypentyl)oxy)benzo[d]isothiazol-3(2H)-one1,1-dioxide (560 mg, 59%) as a pale yellow solid. Agilent EC-MS (Agilent ECMS 1200-6 120, Column: Waters X-l3ridge C18 (50 mm*4.6 mm*3.5 jim); Column Temperature: 40 C.; Flow Rate: 2.0 mE/mm; Mobile Phase: from 95% [water+10 mM NH4HCO3] and 5% [CHCN] to 0% [water+10 mM NH4HCO3] and 100% [CH3CN] in 1.6 mm, then under this condition for 1.4 mm, finally changed to 95% [water+10 mM NH4HCO3] and 5% [CH3CN] in 0.1 mm and under this condition for 0.7 mm). Purity is 78.69%, Rt1.159 mm; MS Calcd.: 285.1; MS Found: 284.2 [M-H].
The raw materials were furfuryl alcohol (Shanghai Titan Technology Co., Ltd., the same below).Add 1000mg of raw material to the autoclave.Add 10ml of acetic acid,0.5 wt% Pt/C and 2 wt% W(OTf)6,Applying a hydrogen pressure of 10 atm,Heated to 150 C in a magnetic stirrer,The reaction was kept for 6 hours.The speed is 500r/min.Then cooling,The heterogeneous catalyst was removed by filtration.The ester intermediate is then refluxed in a solution of methanol and water.Then spin dry the methanol,Extract three times with an organic solvent such as ethyl acetate.Spin the organic layer,Alcohols are available.Finally through the gas phase (Shimadzu GC-2014C),The measurement was performed using a DM-wax column (30 m * 0.32 mm * 0.25 mum).
26%; 44.2%; 13%
With Cu(50),Zn(50) (X); hydrogen; at 170℃; under 112511 - 187519 Torr; for 2h;Autoclave;
Copper-Zinc Metal Catalyst In a 200 mL autoclave, 100 g of furfuryl alcohol (1.019 mol, furfural-derived starting material), Reference Example 4 (Metal component ratio: Cu / Zn = 50/50; 5.0% by mass based on the amount of furfuryl alcohol used) was added to the autoclave, and the interior of the autoclave was purged with nitrogen gas After replacing the gas 5 times with hydrogen gas 5 times, hydrogen gas was charged so that the internal pressure in the autoclave was 15 MPa. Next, after setting the reaction temperature to 170 C., hydrogen gas was further charged so that the internal pressure in the autoclave was 25 MPa, and the reaction was carried out for 2 hours. After completion of the reaction, the autoclave was allowed to cool to room temperature, the autoclave was opened, and the catalyst was filtered. Quantitative analysis of the obtained reaction liquid by gas chromatography revealed that 1,2-pentanediol was reacted at a reaction conversion rate of furfuryl alcohol of 98.6% and a reaction selectivity of 32.5% (reaction yield: 32 , 0%), 1,5-pentanediol (reaction yield: 10.3%) was obtained at a reaction selectivity of 10.5%. The reaction yield of 1-pentanol as a by-product was 14.0%, the reaction yield of 2-methylfuran was 26.6%, and the reaction yield of tetrahydrofurfuryl alcohol was 7.0% .
The raw material was 2,5-dimethylfuran.Add 1000mg of raw material to the autoclave.Add 10ml of propionic acid,0.5 wt% Pd/C and 2 wt% Sc(OTf)3,Applying a hydrogen pressure of 10 atm,Heated to 150 C in a magnetic stirrer,The reaction was kept for 6 hours.The speed is 500r/min.Then cooling,The heterogeneous catalyst was removed by filtration.The ester intermediate is then refluxed in a solution of methanol and water.Then spin dry the methanol,Add three times with an organic solvent (such as ethyl acetate).Spin the organic layer,Alcohols are available.Finally through the gas phase (Shimadzu GC-2014C),The measurement was carried out using a DM-wax column (30 m * 0.32 mm * 0.25 mum).
The starting material was 2-methylfuran.Add 1000mg of raw material to the autoclave.Add 10ml of propionic acid,0.5 wt% Pd/C and 2 wt% Sc(OTf)3,Applying a hydrogen pressure of 10 atm,Heated to 150 C in a magnetic stirrer,The reaction was kept for 6 hours.The speed is 500r/min.Then cooling,The heterogeneous catalyst was removed by filtration.The ester intermediate is then refluxed in a solution of methanol and water.Then spin dry the methanol,Add three times with an organic solvent (such as ethyl acetate).Spin the organic layer,Alcohols are available.Finally through the gas phase (Shimadzu GC-2014C),Using a DM-wax column (30m*0.32mm*0.25mum)Determination.
The raw material is furfuryl formate.Add 1000mg of raw material to the autoclave.Add 10ml of acetic acid,5wt% Pd/C and 5wt% Sc(OTf)3,Applying a hydrogen pressure of 10 atm,Heated to 100 C in a magnetic stirrer,The reaction was kept for 6 hours.The speed is 500r/min.Then cooling,The heterogeneous catalyst was removed by filtration.The ester intermediate is then refluxed in a solution of methanol and water.Then spin dry the methanol,Adding organic solvent to ethyl acetate for three times.Spin the organic layer,Alcohols are available.Finally through the gas phase (Shimadzu GC-2014C),The measurement was performed using a DM-wax column (30 m * 0.32 mm * 0.25 mum).
The raw material is furfuryl acetate.Add 1000 mg of raw material to the autoclave.Add 10 ml of acetic acid,5% by weight of palladium/ruthenium and 5% by weight of ruthenium (OTF) 3,Apply 10ATM hydrogen pressure,When heated to 100 C in a magnetic stirrer,The reaction was kept for 6 hours.The speed is 500 rpm.Then cooling,The heterogeneous catalyst was removed by filtration.The ester intermediate is then refluxed in a solution of methanol and water.Then spin dry the methanol,Adding organic solvent to ethyl acetate for three times.Spin the organic layer,Alcohols are available.Finally through the gas phase (Shimadzu GC-2014C),The measurement was performed using a DM-wax column (30 m * 0.32 mm * 0.25 mum).
The raw material is 2-furaldehyde.Add 1000mg of raw material to the autoclave.Add 10ml of acetic acid,0.5 wt% Pd/C and 2 wt% Sc(OTf)3,Applying a hydrogen pressure of 10 atm,Heated to 100 C in a magnetic stirrer,The reaction was kept for 6 hours.The speed is 500r/min.Then cooling,The heterogeneous catalyst was removed by filtration.The ester intermediate is then refluxed in a solution of methanol and water.Then spin dry the methanol,Extract three times with an organic solvent such as ethyl acetate.Spin the organic layer,Alcohols are available.Finally through the gas phase (Shimadzu GC-2014C),The measurement was performed using a DM-wax column (30 m * 0.32 mm * 0.25 mum).
With Cu(50),Zn(50) (X); hydrogen; at 170℃; under 112511 - 187519 Torr; for 2h;Autoclave;
Copper-Zinc Metal Catalyst In a 200 mL autoclave, 100 g of furfuryl alcohol (1.019 mol, furfural-derived starting material), Reference Example 4 (Metal component ratio: Cu / Zn = 50/50; 5.0% by mass based on the amount of furfuryl alcohol used) was added to the autoclave, and the interior of the autoclave was purged with nitrogen gas After replacing the gas 5 times with hydrogen gas 5 times, hydrogen gas was charged so that the internal pressure in the autoclave was 15 MPa. Next, after setting the reaction temperature to 170 C., hydrogen gas was further charged so that the internal pressure in the autoclave was 25 MPa, and the reaction was carried out for 2 hours. After completion of the reaction, the autoclave was allowed to cool to room temperature, the autoclave was opened, and the catalyst was filtered. Quantitative analysis of the obtained reaction liquid by gas chromatography revealed that 1,2-pentanediol was reacted at a reaction conversion rate of furfuryl alcohol of 98.6% and a reaction selectivity of 32.5% (reaction yield: 32 , 0%), 1,5-pentanediol (reaction yield: 10.3%) was obtained at a reaction selectivity of 10.5%. The reaction yield of 1-pentanol as a by-product was 14.0%, the reaction yield of 2-methylfuran was 26.6%, and the reaction yield of tetrahydrofurfuryl alcohol was 7.0% .
To a stirred solution of pentane 1,5-diol 1 (11 g, 105.76 mmol) in N,N-dimethyl formamide (30 mL) was treated with 60 % of NaH (4.5 g, 116.34 mmol) at 0 C and stirred at room temperature for 30 min.1-bromo-2-ethoxyethane 2 (12 mL, 105.76 mmol) in N, N-dimethyl formamide (20 mL) was added to the above reaction mixture at 0 C and stirred at room temperature and stirred for 16 h under argon atmosphere. The reaction mixture was quenched with ice water (200 mL) and extracted with ethyl acetate (3 x 250 mL). Combined organic layers were washed with brine (2 x 100 mL) and dried over Na2SO4, evaporated under reduced pressure. Crude residue was purified by column chromatography (100-200 silica gel) using 30 % ethyl acetate in hexanes to afford 5-(2-ethoxyethoxy) pentan-1ol 3 (5.1 g, 28.97 mmol, 27 % yield) as an oily liquid. TLC system: 70 % ethyl acetate in hexanes - Rf: 0.50; LCMS: m/z = 199.12 (M+Na) +
27%
To a stirred solution of pentane 1,5-diol 1 (11 g, 105.76 mmol) in N,N-dimethyl formamide (30 mL) was treated with 60 % of NaH (4.5 g, 116.34 mmol) at 0 C and stirred at room temperature for 30 min.1-bromo-2-ethoxyethane 2 (12 mL, 105.76 mmol) in N, N- dimethyl formamide (20 mL) was added to the above reaction mixture at 0 C and stirred at room temperature and stirred for 16 h under argon atmosphere. The reaction mixture was quenched with ice water (200 mL) and extracted with ethyl acetate (3 x 250 mL). Combined organic layers were washed with brine (2 x 100 mL) and dried over Na2SO4, evaporated under reduced pressure. Crude residue was purified by column chromatography (100-200 silica gel) using 30 % ethyl acetate in hexanes to afford 5-(2-ethoxyethoxy) pentan-1ol 3 (5.1 g, 28.97 mmol, 27 % yield) as an oily liquid. TLC system: 70 % ethyl acetate in hexanes - Rf: 0.50; LCMS: m/z = 199.12 (M+Na) +
With dmap; 1-ethyl-(3-(3-dimethylamino)propyl)-carbodiimide hydrochloride In dichloromethane at 20℃; for 72h;
Intermediate 113a: 5-Hydroxypentyl 5-bromopentanoate
Intermediate 113a: 5-Hydroxypentyl 5-bromopentanoate Pentane-1,5-diol (2.32 mL, 22.1 mmol) was added to 5-bromovaleric acid (1.00 g, 5.52 mmol), 4-(dimethylamino)pyridine (0.067 g, 0.55 mmol) and N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (1.27 g, 6.63 mmol) in DCM (25 mL) at 20° C. under air. The resulting solution was stirred at 20° C. for 3 days. The reaction mixture was diluted with EtOAc (100 mL), and washed sequentially with water (3*10 mL), saturated NaHCO3 (2*10 mL), and saturated brine (5 mL). The organic layer was dried with MgSO4, filtered and evaporated to afford crude product. The crude product was purified by flash silica chromatography, elution gradient 5 to 50% EtOAc in heptane to afford the title compound (1.024 g, 69.4%) as a colourless oil. 1H NMR (400 MHz, DMSO, 30° C.) 1.28-1.38 (2H, m), 1.43 (2H, dt), 1.51-1.7 (4H, m), 1.77-1.88 (2H, m), 2.34 (2H, t), 3.34-3.44 (2H, m), 3.54 (2H, t), 4.01 (2H, t), 4.33 (1H, t); m/z: ES+ [M+H]+ 267.2.
10 parts of the compound represented by (I-1-a) and 45 parts of acetonitrile were mixed and stirred at 23 C. for 30 minutes. To the obtained mixture, 15.36 parts of a compound represented by the formula (I-1-b) was added, and the mixture was further stirred at 60 C. for 2 hours. To the obtained reaction mixture, 26.90 parts of a compound represented by the formula (I-3-c) was added, and the mixture was further stirred at 60 C. for 2 hours, and then cooled to 23 C. To the obtained reaction mixture, 100 parts of chloroform and 50 parts of 5% oxalic acid aqueous solution were added and stirred at 23 C. for 30 minutes, followed by liquid separation to take out an organic layer. To the obtained organic layer, 50 parts of ion exchange water was added and stirred at 23 C. for 30 minutes, followed by liquid separation to take out the organic layer. This washing operation was repeated 5 times. The obtained organic layer was concentrated, and the concentrated residue was purified using a column (silica gel 60N (spherical, neutral) 100-210 mum; manufactured by Kanto Chemical Co., Inc., developing solvent: n-heptane / ethyl acetate = 1/1). By fractionation, 12.33 parts of a compound represented by the formula (I-3-d) was obtained.
With ammonia; hydrogen In water at 80℃; for 1h; Autoclave;
2.4. Catalytic test and product analysis
General procedure: The discontinuous 2-HTHP reductive amination reaction was carried out in a 100 mL stainless steel autoclave reactor at a stirring speed of 800 rpm. Prior to the reaction, the calcined Ni catalysts were reduced at 450 °C in pure H2 at a flow rate of 80 mL min-1 for 3 h. In a typical experiment, 15 g of the 21.8 wt% 2-HTHP aqueous solution together with 15 g of the 25 wt% concentrated ammonia solution was added into the reactor. The reduced catalyst, which was sealed in a H2 atmosphere,was quickly tipped into the reaction solution to avoid oxidation. After flushing the tightly sealed reactor with H2 3 times, thereactor was initially pressurized with H2 to 2.0 MPa, and then heated to 80 °C, a temperature that was maintained during thereaction. The stability of the selected catalyst was studied using acontinuous flow reactor (length: 36 cm, and inner diameter: 0.9cm) at 80 °C and 3 MPa H2. The calcined catalyst (2.0 g) withsizes of 20-40 meshes was embedded with quartz powders (20-40 meshes) in both sides of the catalyst bed. The catalyst was prereduced at 450 °C in pure H2 at atmospheric pressure and a flow rate of 80 mL min-1 for 3 h. After cooling to the reaction temperature, the reactor was pressured to 3 MPa with H2; afterward, a well-mixed solution of 21.8 wt% 2-HTHP aqueous solution and 25 wt% concentrated ammonia at a weight ratio of 1:1 was pumped into the reactor at a speed of 9 g h-1. The H2to 2-HTHP molar ratio was 30. Liquid samples were collected from a stainless-steel gas-liquid separator every 5 to 10 h.
With ammonium hydroxide; hydrogen; at 290℃; under 30003 Torr; for 4h;Autoclave;
accurately weigh 416 g of PDO (4 mol), 328 g of 25 wt.% Ammonia solution (containing 4.8 mol ammonia), 520 g of benzyl alcohol (4.8 mol), 94 g of 3% Cu-3 % Ni-0.2% Pd / ZSM-5 catalyst, react in a 4L reactor under 4MPaH2 atmosphere, set the reaction temperature to 290C, and end the reaction after 4h. Is 37%.
With F101S-Phanerochaete chrysosporium In aq. phosphate buffer at 35℃; Enzymatic reaction;
> 86 %Chromat.
With 1-methyl-1H-imidazole; copper(l) iodide; 2,2,6,6-Tetramethyl-1-piperidinyloxy free radical; C12H8F3NOS In acetonitrile at 20℃; for 3h;
2.3. Oxidations
General procedure: Oxidation reactions were performed in 3 ml or 5 ml MeCN solutionsat room temperature under open air conditions. The reaction was set upby adding 4 mol% of copper(I)iodine, 4 mol% of ligand, solvent, 5 mol%of TEMPO, 1 mmol of alcohol and 10 mol% of NMI into a 20 ml test tube,which was equipped with a magnetic stir bar. The reaction was stirred at 1500 rpm for 1 h, 3 h or 24 h depending on the substrate.After the reaction, the reaction solution and an internal standard(acetophenone 40 μL or 1,2-dichlorobenzene 40 μL, see ESI for moreinformation) were diluted with EtOAc (50 mL). GC samples (1.5 mL)were prepared by filtrating the solution through a layer of silica gel (1cm thick). The yields were determined using GC-FID with calibration curves and identified using GC-MS and/or 1H/13C/HMBC/HSQC NMR.
79 %Chromat.
With copper(l) iodide; di(pyridin-2-yl)amine; 2,2,6,6-Tetramethyl-1-piperidinyloxy free radical In acetonitrile at 20℃; for 24h;
Oxidations
General procedure: Oxidation reactions were performed in 3 mL MeCN or in a mixture of2 mL MeCN and 1 mL H2O solutions at room temperature under open airconditions. The reaction was set up by adding 2.5 mol% of copper(I)iodine, 2.5 mol% of ligand, 3 mL solvent, 4 mol% of TEMPO and 1 mmol of alcohol into a 20 ml test tube, which was equipped with a magneticstir bar. The reaction was stirred at 1500 rpm for 1 h, 3 h or 24 h depending on the substrate. After the reaction, the reaction solution andan internal standard (acetophenone 40 μL or 1,2-dichlorobenzene 40 μL,see ESI for more information) were diluted with EtOAc (50 mL). GCsamples (1.5 mL) were prepared by filtrating the solution through alayer of silica gel (1 cm thick). The yields were determined using GC-FIDwith calibration curves and identified using GC-MS and/or 1H/13C/HMBC/HSQC NMR.
With dmap; 1-ethyl-(3-(3-dimethylamino)propyl)-carbodiimide hydrochloride In ethyl acetate at 25℃; for 12h; Inert atmosphere;
<Synthesis of Intermediate 2A>
A reactor equipped with a stirrer and a nitrogen introduction tube was prepared. In the reactor, 1,5-pentanediol (3.0 parts, manufactured by Tokyo Chemical Industry Co., Ltd.), 4-benzyloxybenzoic acid (13.8 parts, manufactured by Tokyo Chemical Industry Co., Ltd.), 1-ethyl-3- (3-). Dimethylaminopropyl) Carbodiimide (9.4 parts, manufactured by Tokyo Chemical Industry Co., Ltd.), 4-Dimethylaminopyridine (0.7 parts, manufactured by Tokyo Chemical Industry Co., Ltd.) and ethyl acetate (152.6 parts, manufactured by Kanto Chemical Co., Inc.) In addition, the mixture was stirred at 25 ° C. for 12 hours in a nitrogen atmosphere to react. After completion of the reaction, a 1 wt% aqueous hydrochloric acid solution (200 parts) was added, the ethyl acetate layer was extracted, and the ethyl acetate layer was concentrated. By silica gel column chromatography using chloroform, 3.3 parts (yield: 22%) of Intermediate 2A was obtained.
Chemistry
Pharmaceutical Intermediates
Inhibitors/Agonists
Material Science
For Research Only
120K+ Compounds
Competitive Price
1-2 Day Shipping
